Incidental Mutation 'R1775:Scn7a'
ID 204287
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 039806-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R1775 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66511299 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1207 (N1207S)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably benign
Transcript: ENSMUST00000042792
AA Change: N1207S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: N1207S

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,272,143 (GRCm39) S20P unknown Het
4921528I07Rik G A 9: 114,108,386 (GRCm39) noncoding transcript Het
4930562C15Rik G A 16: 4,669,422 (GRCm39) probably null Het
4933427I04Rik A G 4: 123,754,286 (GRCm39) T67A possibly damaging Het
Abcc2 A T 19: 43,786,858 (GRCm39) N160Y possibly damaging Het
Acaca A G 11: 84,191,248 (GRCm39) D155G possibly damaging Het
Afg3l1 G A 8: 124,219,639 (GRCm39) R389Q possibly damaging Het
Ank2 G A 3: 126,728,196 (GRCm39) T799M probably benign Het
Anxa2 T C 9: 69,395,363 (GRCm39) Y202H possibly damaging Het
Arhgef33 A G 17: 80,681,172 (GRCm39) T771A probably benign Het
Atp12a T C 14: 56,610,046 (GRCm39) V182A probably benign Het
Birc6 T C 17: 74,919,281 (GRCm39) L210S probably damaging Het
Car3 A G 3: 14,929,492 (GRCm39) T73A probably benign Het
Cd5l T C 3: 87,275,966 (GRCm39) L312P probably damaging Het
Celf5 A G 10: 81,303,138 (GRCm39) probably benign Het
Cep290 T A 10: 100,332,672 (GRCm39) V257E probably damaging Het
Cntrob T C 11: 69,211,693 (GRCm39) D177G possibly damaging Het
Copg2 A T 6: 30,787,271 (GRCm39) F658I probably damaging Het
Csmd3 T C 15: 47,763,135 (GRCm39) T1234A probably damaging Het
Dhx35 A G 2: 158,648,357 (GRCm39) T72A probably damaging Het
Dmrtc2 A T 7: 24,573,792 (GRCm39) H209L possibly damaging Het
Eml5 G T 12: 98,818,963 (GRCm39) probably null Het
Evpl T C 11: 116,114,486 (GRCm39) E1068G possibly damaging Het
Ezh2 A G 6: 47,553,594 (GRCm39) M41T probably damaging Het
Fmo3 A G 1: 162,796,294 (GRCm39) S93P possibly damaging Het
Gdi2 A G 13: 3,610,018 (GRCm39) Y213C possibly damaging Het
Gpr15 A T 16: 58,538,921 (GRCm39) I56K probably benign Het
Gria2 G T 3: 80,598,645 (GRCm39) S796R probably benign Het
Hectd4 T A 5: 121,429,254 (GRCm39) probably benign Het
Hgfac T C 5: 35,200,194 (GRCm39) probably benign Het
Hspg2 C T 4: 137,247,467 (GRCm39) R1200W probably damaging Het
Ift52 G A 2: 162,867,275 (GRCm39) D78N possibly damaging Het
Iqca1 C A 1: 90,009,138 (GRCm39) W415L probably damaging Het
Ism1 A T 2: 139,587,963 (GRCm39) K236N probably damaging Het
Itgb6 C T 2: 60,502,988 (GRCm39) W43* probably null Het
Kcnk18 T A 19: 59,223,773 (GRCm39) I306N probably damaging Het
Kctd8 T C 5: 69,497,903 (GRCm39) K248E probably damaging Het
Layn T A 9: 50,970,833 (GRCm39) I237F probably benign Het
Lce3f C T 3: 92,900,248 (GRCm39) P23L unknown Het
Lct A G 1: 128,228,038 (GRCm39) F1152L probably damaging Het
Mettl25b A G 3: 87,831,124 (GRCm39) S404P probably damaging Het
Mxra8 T C 4: 155,927,531 (GRCm39) I413T probably damaging Het
Nedd9 A G 13: 41,471,438 (GRCm39) V187A probably benign Het
Net1 A G 13: 3,937,642 (GRCm39) L207P probably damaging Het
Neurod1 G T 2: 79,284,781 (GRCm39) P201T probably benign Het
Nlrp1b A G 11: 71,052,647 (GRCm39) F927S probably damaging Het
Ntrk3 T A 7: 78,005,789 (GRCm39) H524L possibly damaging Het
Nup98 A C 7: 101,784,144 (GRCm39) S1063A probably benign Het
Or10ak11 T A 4: 118,687,065 (GRCm39) M191L probably benign Het
Or11h4b G T 14: 50,918,623 (GRCm39) P156Q possibly damaging Het
Or56b1 G A 7: 104,285,366 (GRCm39) V162I probably benign Het
Or5b97 C A 19: 12,878,599 (GRCm39) V182F probably benign Het
Or5m9b G A 2: 85,905,104 (GRCm39) V7I possibly damaging Het
Or6d15 T C 6: 116,559,925 (GRCm39) probably benign Het
Pdzd2 G A 15: 12,592,546 (GRCm39) R33W probably damaging Het
Phf21a G A 2: 92,160,860 (GRCm39) V243I probably damaging Het
Ppp1r12b A G 1: 134,821,086 (GRCm39) probably null Het
Rexo5 T C 7: 119,444,634 (GRCm39) V703A probably benign Het
Rgs4 A G 1: 169,572,847 (GRCm39) S30P probably benign Het
Rxra C A 2: 27,646,256 (GRCm39) D340E probably damaging Het
Samhd1 A G 2: 156,949,467 (GRCm39) V473A probably benign Het
Scn3a T A 2: 65,302,686 (GRCm39) K1253N probably damaging Het
Sec24d T A 3: 123,130,166 (GRCm39) I443N probably damaging Het
Sema4g T A 19: 44,987,681 (GRCm39) probably null Het
Sema5b A G 16: 35,480,694 (GRCm39) K787R probably benign Het
Serpinc1 A G 1: 160,817,217 (GRCm39) N104D probably benign Het
Sfn T C 4: 133,328,542 (GRCm39) H180R probably damaging Het
Slc22a6 G T 19: 8,596,471 (GRCm39) probably null Het
Slc9a8 T C 2: 167,299,278 (GRCm39) S217P probably benign Het
Smc6 A G 12: 11,359,270 (GRCm39) N965D probably benign Het
Sod2 T A 17: 13,233,919 (GRCm39) I177N probably damaging Het
Sp4 A T 12: 118,263,335 (GRCm39) I237K probably damaging Het
Sulf2 T C 2: 165,921,532 (GRCm39) K697R probably benign Het
Svs4 A T 2: 164,119,005 (GRCm39) D110E unknown Het
Tas1r1 T A 4: 152,122,675 (GRCm39) R57* probably null Het
Tlr5 T C 1: 182,801,287 (GRCm39) I197T probably damaging Het
Tmc3 T C 7: 83,261,740 (GRCm39) V606A probably benign Het
Tmem241 T A 18: 12,251,469 (GRCm39) L37F probably damaging Het
Tmem59l A T 8: 70,938,903 (GRCm39) N90K probably damaging Het
Tram1 A C 1: 13,646,680 (GRCm39) probably benign Het
Trim15 T A 17: 37,176,061 (GRCm39) H162L probably benign Het
Ttc28 T A 5: 111,424,677 (GRCm39) Y1501N probably benign Het
Ttc34 T C 4: 154,946,671 (GRCm39) V857A probably benign Het
Tulp4 A G 17: 6,189,321 (GRCm39) T48A probably damaging Het
Usp9y T C Y: 1,368,089 (GRCm39) E939G probably damaging Het
Utp20 A G 10: 88,606,670 (GRCm39) I1634T probably benign Het
Vmn2r72 T C 7: 85,387,378 (GRCm39) M729V probably benign Het
Vps13c C T 9: 67,788,729 (GRCm39) T334M probably damaging Het
Wnk4 C G 11: 101,167,166 (GRCm39) probably benign Het
Xpo1 A G 11: 23,221,193 (GRCm39) N97D probably benign Het
Xpo4 A T 14: 57,841,129 (GRCm39) F518Y probably benign Het
Zfp668 C T 7: 127,465,778 (GRCm39) V469I possibly damaging Het
Zfp85 C A 13: 67,897,823 (GRCm39) C83F probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCACTTGAATCCTTTGTC -3'
(R):5'- TTGTCATGGCAGGCCTCTTG -3'

Sequencing Primer
(F):5'- GATTGCAGGCACTTTCCACTACAG -3'
(R):5'- ATGGCAGGCCTCTTGTGTCTTC -3'
Posted On 2014-06-23