Incidental Mutation 'R1775:Or5m9b'
ID 204289
Institutional Source Beutler Lab
Gene Symbol Or5m9b
Ensembl Gene ENSMUSG00000099820
Gene Name olfactory receptor family 5 subfamily M member 9B
Synonyms Olfr1036, GA_x6K02T2Q125-47549689-47550621, MOR262-13, MOR245-25
MMRRC Submission 039806-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.273) question?
Stock # R1775 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85905048-85906062 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85905104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 7 (V7I)
Ref Sequence ENSEMBL: ENSMUSP00000130843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164985]
AlphaFold Q7TR85
Predicted Effect possibly damaging
Transcript: ENSMUST00000164985
AA Change: V7I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130843
Gene: ENSMUSG00000099820
AA Change: V7I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.2e-51 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,272,143 (GRCm39) S20P unknown Het
4921528I07Rik G A 9: 114,108,386 (GRCm39) noncoding transcript Het
4930562C15Rik G A 16: 4,669,422 (GRCm39) probably null Het
4933427I04Rik A G 4: 123,754,286 (GRCm39) T67A possibly damaging Het
Abcc2 A T 19: 43,786,858 (GRCm39) N160Y possibly damaging Het
Acaca A G 11: 84,191,248 (GRCm39) D155G possibly damaging Het
Afg3l1 G A 8: 124,219,639 (GRCm39) R389Q possibly damaging Het
Ank2 G A 3: 126,728,196 (GRCm39) T799M probably benign Het
Anxa2 T C 9: 69,395,363 (GRCm39) Y202H possibly damaging Het
Arhgef33 A G 17: 80,681,172 (GRCm39) T771A probably benign Het
Atp12a T C 14: 56,610,046 (GRCm39) V182A probably benign Het
Birc6 T C 17: 74,919,281 (GRCm39) L210S probably damaging Het
Car3 A G 3: 14,929,492 (GRCm39) T73A probably benign Het
Cd5l T C 3: 87,275,966 (GRCm39) L312P probably damaging Het
Celf5 A G 10: 81,303,138 (GRCm39) probably benign Het
Cep290 T A 10: 100,332,672 (GRCm39) V257E probably damaging Het
Cntrob T C 11: 69,211,693 (GRCm39) D177G possibly damaging Het
Copg2 A T 6: 30,787,271 (GRCm39) F658I probably damaging Het
Csmd3 T C 15: 47,763,135 (GRCm39) T1234A probably damaging Het
Dhx35 A G 2: 158,648,357 (GRCm39) T72A probably damaging Het
Dmrtc2 A T 7: 24,573,792 (GRCm39) H209L possibly damaging Het
Eml5 G T 12: 98,818,963 (GRCm39) probably null Het
Evpl T C 11: 116,114,486 (GRCm39) E1068G possibly damaging Het
Ezh2 A G 6: 47,553,594 (GRCm39) M41T probably damaging Het
Fmo3 A G 1: 162,796,294 (GRCm39) S93P possibly damaging Het
Gdi2 A G 13: 3,610,018 (GRCm39) Y213C possibly damaging Het
Gpr15 A T 16: 58,538,921 (GRCm39) I56K probably benign Het
Gria2 G T 3: 80,598,645 (GRCm39) S796R probably benign Het
Hectd4 T A 5: 121,429,254 (GRCm39) probably benign Het
Hgfac T C 5: 35,200,194 (GRCm39) probably benign Het
Hspg2 C T 4: 137,247,467 (GRCm39) R1200W probably damaging Het
Ift52 G A 2: 162,867,275 (GRCm39) D78N possibly damaging Het
Iqca1 C A 1: 90,009,138 (GRCm39) W415L probably damaging Het
Ism1 A T 2: 139,587,963 (GRCm39) K236N probably damaging Het
Itgb6 C T 2: 60,502,988 (GRCm39) W43* probably null Het
Kcnk18 T A 19: 59,223,773 (GRCm39) I306N probably damaging Het
Kctd8 T C 5: 69,497,903 (GRCm39) K248E probably damaging Het
Layn T A 9: 50,970,833 (GRCm39) I237F probably benign Het
Lce3f C T 3: 92,900,248 (GRCm39) P23L unknown Het
Lct A G 1: 128,228,038 (GRCm39) F1152L probably damaging Het
Mettl25b A G 3: 87,831,124 (GRCm39) S404P probably damaging Het
Mxra8 T C 4: 155,927,531 (GRCm39) I413T probably damaging Het
Nedd9 A G 13: 41,471,438 (GRCm39) V187A probably benign Het
Net1 A G 13: 3,937,642 (GRCm39) L207P probably damaging Het
Neurod1 G T 2: 79,284,781 (GRCm39) P201T probably benign Het
Nlrp1b A G 11: 71,052,647 (GRCm39) F927S probably damaging Het
Ntrk3 T A 7: 78,005,789 (GRCm39) H524L possibly damaging Het
Nup98 A C 7: 101,784,144 (GRCm39) S1063A probably benign Het
Or10ak11 T A 4: 118,687,065 (GRCm39) M191L probably benign Het
Or11h4b G T 14: 50,918,623 (GRCm39) P156Q possibly damaging Het
Or56b1 G A 7: 104,285,366 (GRCm39) V162I probably benign Het
Or5b97 C A 19: 12,878,599 (GRCm39) V182F probably benign Het
Or6d15 T C 6: 116,559,925 (GRCm39) probably benign Het
Pdzd2 G A 15: 12,592,546 (GRCm39) R33W probably damaging Het
Phf21a G A 2: 92,160,860 (GRCm39) V243I probably damaging Het
Ppp1r12b A G 1: 134,821,086 (GRCm39) probably null Het
Rexo5 T C 7: 119,444,634 (GRCm39) V703A probably benign Het
Rgs4 A G 1: 169,572,847 (GRCm39) S30P probably benign Het
Rxra C A 2: 27,646,256 (GRCm39) D340E probably damaging Het
Samhd1 A G 2: 156,949,467 (GRCm39) V473A probably benign Het
Scn3a T A 2: 65,302,686 (GRCm39) K1253N probably damaging Het
Scn7a T C 2: 66,511,299 (GRCm39) N1207S probably benign Het
Sec24d T A 3: 123,130,166 (GRCm39) I443N probably damaging Het
Sema4g T A 19: 44,987,681 (GRCm39) probably null Het
Sema5b A G 16: 35,480,694 (GRCm39) K787R probably benign Het
Serpinc1 A G 1: 160,817,217 (GRCm39) N104D probably benign Het
Sfn T C 4: 133,328,542 (GRCm39) H180R probably damaging Het
Slc22a6 G T 19: 8,596,471 (GRCm39) probably null Het
Slc9a8 T C 2: 167,299,278 (GRCm39) S217P probably benign Het
Smc6 A G 12: 11,359,270 (GRCm39) N965D probably benign Het
Sod2 T A 17: 13,233,919 (GRCm39) I177N probably damaging Het
Sp4 A T 12: 118,263,335 (GRCm39) I237K probably damaging Het
Sulf2 T C 2: 165,921,532 (GRCm39) K697R probably benign Het
Svs4 A T 2: 164,119,005 (GRCm39) D110E unknown Het
Tas1r1 T A 4: 152,122,675 (GRCm39) R57* probably null Het
Tlr5 T C 1: 182,801,287 (GRCm39) I197T probably damaging Het
Tmc3 T C 7: 83,261,740 (GRCm39) V606A probably benign Het
Tmem241 T A 18: 12,251,469 (GRCm39) L37F probably damaging Het
Tmem59l A T 8: 70,938,903 (GRCm39) N90K probably damaging Het
Tram1 A C 1: 13,646,680 (GRCm39) probably benign Het
Trim15 T A 17: 37,176,061 (GRCm39) H162L probably benign Het
Ttc28 T A 5: 111,424,677 (GRCm39) Y1501N probably benign Het
Ttc34 T C 4: 154,946,671 (GRCm39) V857A probably benign Het
Tulp4 A G 17: 6,189,321 (GRCm39) T48A probably damaging Het
Usp9y T C Y: 1,368,089 (GRCm39) E939G probably damaging Het
Utp20 A G 10: 88,606,670 (GRCm39) I1634T probably benign Het
Vmn2r72 T C 7: 85,387,378 (GRCm39) M729V probably benign Het
Vps13c C T 9: 67,788,729 (GRCm39) T334M probably damaging Het
Wnk4 C G 11: 101,167,166 (GRCm39) probably benign Het
Xpo1 A G 11: 23,221,193 (GRCm39) N97D probably benign Het
Xpo4 A T 14: 57,841,129 (GRCm39) F518Y probably benign Het
Zfp668 C T 7: 127,465,778 (GRCm39) V469I possibly damaging Het
Zfp85 C A 13: 67,897,823 (GRCm39) C83F probably damaging Het
Other mutations in Or5m9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Or5m9b APN 2 85,905,816 (GRCm39) missense possibly damaging 0.90
IGL02370:Or5m9b APN 2 85,905,132 (GRCm39) missense probably damaging 0.98
R0269:Or5m9b UTSW 2 85,905,485 (GRCm39) missense probably benign 0.03
R0409:Or5m9b UTSW 2 85,905,646 (GRCm39) nonsense probably null
R0412:Or5m9b UTSW 2 85,905,435 (GRCm39) missense probably benign 0.16
R0617:Or5m9b UTSW 2 85,905,485 (GRCm39) missense probably benign 0.03
R0846:Or5m9b UTSW 2 85,905,510 (GRCm39) missense possibly damaging 0.66
R1251:Or5m9b UTSW 2 85,905,164 (GRCm39) missense probably benign 0.20
R1646:Or5m9b UTSW 2 85,905,960 (GRCm39) missense probably damaging 0.98
R1670:Or5m9b UTSW 2 85,905,594 (GRCm39) missense probably benign
R1968:Or5m9b UTSW 2 85,905,549 (GRCm39) missense probably damaging 1.00
R2877:Or5m9b UTSW 2 85,905,675 (GRCm39) missense possibly damaging 0.82
R4639:Or5m9b UTSW 2 85,905,923 (GRCm39) missense probably benign 0.24
R4957:Or5m9b UTSW 2 85,905,854 (GRCm39) missense probably damaging 1.00
R5267:Or5m9b UTSW 2 85,905,882 (GRCm39) missense probably benign 0.28
R5862:Or5m9b UTSW 2 85,905,990 (GRCm39) missense probably benign 0.00
R6235:Or5m9b UTSW 2 85,905,510 (GRCm39) missense possibly damaging 0.66
R6355:Or5m9b UTSW 2 85,905,216 (GRCm39) missense probably benign 0.04
R6943:Or5m9b UTSW 2 85,905,264 (GRCm39) missense probably damaging 1.00
R8033:Or5m9b UTSW 2 85,905,219 (GRCm39) missense possibly damaging 0.61
R8796:Or5m9b UTSW 2 85,905,518 (GRCm39) missense possibly damaging 0.94
R8861:Or5m9b UTSW 2 85,905,960 (GRCm39) missense probably damaging 0.98
Z1088:Or5m9b UTSW 2 85,905,667 (GRCm39) missense possibly damaging 0.66
Z1177:Or5m9b UTSW 2 85,905,768 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGCTACCCTGTAACACATTTGAAC -3'
(R):5'- TCCACAAAGGACAAATGACTTAGG -3'

Sequencing Primer
(F):5'- ACCCTGTAACACATTTGAACATTTAG -3'
(R):5'- CAGGCTGATGCTGATCAA -3'
Posted On 2014-06-23