Incidental Mutation 'R1775:Slc9a8'
ID 204299
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms 1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission 039806-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1775 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 167421712-167477000 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 167457358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 217 (S217P)
Ref Sequence ENSEMBL: ENSMUSP00000104841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
AlphaFold Q8R4D1
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: S244P

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: S244P

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: S217P

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: S217P

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: S217P

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: S217P

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155585
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 (GRCm38) S20P unknown Het
4921528I07Rik G A 9: 114,279,318 (GRCm38) noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 (GRCm38) probably null Het
4933427I04Rik A G 4: 123,860,493 (GRCm38) T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 (GRCm38) N160Y possibly damaging Het
Acaca A G 11: 84,300,422 (GRCm38) D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 (GRCm38) R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 (GRCm38) T799M probably benign Het
Anxa2 T C 9: 69,488,081 (GRCm38) Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 (GRCm38) T771A probably benign Het
Atp12a T C 14: 56,372,589 (GRCm38) V182A probably benign Het
Birc6 T C 17: 74,612,286 (GRCm38) L210S probably damaging Het
Car3 A G 3: 14,864,432 (GRCm38) T73A probably benign Het
Cd5l T C 3: 87,368,659 (GRCm38) L312P probably damaging Het
Celf5 A G 10: 81,467,304 (GRCm38) probably benign Het
Cep290 T A 10: 100,496,810 (GRCm38) V257E probably damaging Het
Cntrob T C 11: 69,320,867 (GRCm38) D177G possibly damaging Het
Copg2 A T 6: 30,810,336 (GRCm38) F658I probably damaging Het
Csmd3 T C 15: 47,899,739 (GRCm38) T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 (GRCm38) T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 (GRCm38) H209L possibly damaging Het
Eml5 G T 12: 98,852,704 (GRCm38) probably null Het
Evpl T C 11: 116,223,660 (GRCm38) E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 (GRCm38) M41T probably damaging Het
Fmo3 A G 1: 162,968,725 (GRCm38) S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 (GRCm38) Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 (GRCm38) I56K probably benign Het
Gria2 G T 3: 80,691,338 (GRCm38) S796R probably benign Het
Hectd4 T A 5: 121,291,191 (GRCm38) probably benign Het
Hgfac T C 5: 35,042,850 (GRCm38) probably benign Het
Hspg2 C T 4: 137,520,156 (GRCm38) R1200W probably damaging Het
Ift52 G A 2: 163,025,355 (GRCm38) D78N possibly damaging Het
Iqca C A 1: 90,081,416 (GRCm38) W415L probably damaging Het
Ism1 A T 2: 139,746,043 (GRCm38) K236N probably damaging Het
Itgb6 C T 2: 60,672,644 (GRCm38) W43* probably null Het
Kcnk18 T A 19: 59,235,341 (GRCm38) I306N probably damaging Het
Kctd8 T C 5: 69,340,560 (GRCm38) K248E probably damaging Het
Layn T A 9: 51,059,533 (GRCm38) I237F probably benign Het
Lce3f C T 3: 92,992,941 (GRCm38) P23L unknown Het
Lct A G 1: 128,300,301 (GRCm38) F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 (GRCm38) I413T probably damaging Het
Nedd9 A G 13: 41,317,962 (GRCm38) V187A probably benign Het
Net1 A G 13: 3,887,642 (GRCm38) L207P probably damaging Het
Neurod1 G T 2: 79,454,437 (GRCm38) P201T probably benign Het
Nlrp1b A G 11: 71,161,821 (GRCm38) F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 (GRCm38) H524L possibly damaging Het
Nup98 A C 7: 102,134,937 (GRCm38) S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 (GRCm38) V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 (GRCm38) M191L probably benign Het
Olfr1447 C A 19: 12,901,235 (GRCm38) V182F probably benign Het
Olfr215 T C 6: 116,582,964 (GRCm38) probably benign Het
Olfr657 G A 7: 104,636,159 (GRCm38) V162I probably benign Het
Olfr747 G T 14: 50,681,166 (GRCm38) P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 (GRCm38) R33W probably damaging Het
Phf21a G A 2: 92,330,515 (GRCm38) V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 (GRCm38) probably null Het
Rexo5 T C 7: 119,845,411 (GRCm38) V703A probably benign Het
Rgs4 A G 1: 169,745,278 (GRCm38) S30P probably benign Het
Rrnad1 A G 3: 87,923,817 (GRCm38) S404P probably damaging Het
Rxra C A 2: 27,756,244 (GRCm38) D340E probably damaging Het
Samhd1 A G 2: 157,107,547 (GRCm38) V473A probably benign Het
Scn3a T A 2: 65,472,342 (GRCm38) K1253N probably damaging Het
Scn7a T C 2: 66,680,955 (GRCm38) N1207S probably benign Het
Sec24d T A 3: 123,336,517 (GRCm38) I443N probably damaging Het
Sema4g T A 19: 44,999,242 (GRCm38) probably null Het
Sema5b A G 16: 35,660,324 (GRCm38) K787R probably benign Het
Serpinc1 A G 1: 160,989,647 (GRCm38) N104D probably benign Het
Sfn T C 4: 133,601,231 (GRCm38) H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 (GRCm38) probably null Het
Smc6 A G 12: 11,309,269 (GRCm38) N965D probably benign Het
Sod2 T A 17: 13,015,032 (GRCm38) I177N probably damaging Het
Sp4 A T 12: 118,299,600 (GRCm38) I237K probably damaging Het
Sulf2 T C 2: 166,079,612 (GRCm38) K697R probably benign Het
Svs4 A T 2: 164,277,085 (GRCm38) D110E unknown Het
Tas1r1 T A 4: 152,038,218 (GRCm38) R57* probably null Het
Tlr5 T C 1: 182,973,722 (GRCm38) I197T probably damaging Het
Tmc3 T C 7: 83,612,532 (GRCm38) V606A probably benign Het
Tmem241 T A 18: 12,118,412 (GRCm38) L37F probably damaging Het
Tmem59l A T 8: 70,486,253 (GRCm38) N90K probably damaging Het
Tram1 A C 1: 13,576,456 (GRCm38) probably benign Het
Trim15 T A 17: 36,865,169 (GRCm38) H162L probably benign Het
Ttc28 T A 5: 111,276,811 (GRCm38) Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 (GRCm38) V857A probably benign Het
Tulp4 A G 17: 6,139,046 (GRCm38) T48A probably damaging Het
Usp9y T C Y: 1,368,089 (GRCm38) E939G probably damaging Het
Utp20 A G 10: 88,770,808 (GRCm38) I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 (GRCm38) M729V probably benign Het
Vps13c C T 9: 67,881,447 (GRCm38) T334M probably damaging Het
Wnk4 C G 11: 101,276,340 (GRCm38) probably benign Het
Xpo1 A G 11: 23,271,193 (GRCm38) N97D probably benign Het
Xpo4 A T 14: 57,603,672 (GRCm38) F518Y probably benign Het
Zfp668 C T 7: 127,866,606 (GRCm38) V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 (GRCm38) C83F probably damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167,424,166 (GRCm38) missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167,467,677 (GRCm38) splice site probably benign
costello UTSW 2 167,451,296 (GRCm38) missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167,451,296 (GRCm38) missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167,457,344 (GRCm38) missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167,424,205 (GRCm38) missense probably benign
R0906:Slc9a8 UTSW 2 167,434,867 (GRCm38) intron probably benign
R1216:Slc9a8 UTSW 2 167,424,121 (GRCm38) missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167,471,523 (GRCm38) missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167,471,432 (GRCm38) missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167,424,145 (GRCm38) missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167,424,145 (GRCm38) missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167,471,465 (GRCm38) missense possibly damaging 0.57
R1918:Slc9a8 UTSW 2 167,424,214 (GRCm38) missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167,451,276 (GRCm38) missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167,451,281 (GRCm38) missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167,457,352 (GRCm38) missense probably benign
R3757:Slc9a8 UTSW 2 167,424,130 (GRCm38) missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167,424,193 (GRCm38) missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167,441,170 (GRCm38) nonsense probably null
R4904:Slc9a8 UTSW 2 167,471,396 (GRCm38) missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167,446,529 (GRCm38) missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167,467,722 (GRCm38) missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167,471,387 (GRCm38) nonsense probably null
R5908:Slc9a8 UTSW 2 167,451,170 (GRCm38) intron probably benign
R6311:Slc9a8 UTSW 2 167,451,220 (GRCm38) missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167,434,821 (GRCm38) missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167,424,291 (GRCm38) missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167,465,383 (GRCm38) missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167,451,302 (GRCm38) missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167,474,131 (GRCm38) missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167,465,358 (GRCm38) missense probably benign 0.07
R8095:Slc9a8 UTSW 2 167,468,971 (GRCm38) missense probably damaging 0.99
R8725:Slc9a8 UTSW 2 167,473,534 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAACCACCTCAGTGTCTG -3'
(R):5'- ACAAAATTGGGTCCCTGAGG -3'

Sequencing Primer
(F):5'- GAGCGATACTCAGCTGAT -3'
(R):5'- TTGGGTCCCTGAGGAAGCAG -3'
Posted On 2014-06-23