Mutagenetix > Incidental Mutation

Incidental Mutation 'R1775:Sec24d'

204305

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

039806-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1775 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123336517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 443 (I443N)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably damaging
Transcript: ENSMUST00000047923
AA Change: I443N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: I443N

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196167

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Meta Mutation Damage Score

0.8345

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J04Rik	A	G	12: 11,222,142	S20P	unknown	Het
4921528I07Rik	G	A	9: 114,279,318		noncoding transcript	Het
4930562C15Rik	G	A	16: 4,851,558		probably null	Het
4933427I04Rik	A	G	4: 123,860,493	T67A	possibly damaging	Het
Abcc2	A	T	19: 43,798,419	N160Y	possibly damaging	Het
Acaca	A	G	11: 84,300,422	D155G	possibly damaging	Het
Afg3l1	G	A	8: 123,492,900	R389Q	possibly damaging	Het
Ank2	G	A	3: 126,934,547	T799M	probably benign	Het
Anxa2	T	C	9: 69,488,081	Y202H	possibly damaging	Het
Arhgef33	A	G	17: 80,373,743	T771A	probably benign	Het
Atp12a	T	C	14: 56,372,589	V182A	probably benign	Het
Birc6	T	C	17: 74,612,286	L210S	probably damaging	Het
Car3	A	G	3: 14,864,432	T73A	probably benign	Het
Cd5l	T	C	3: 87,368,659	L312P	probably damaging	Het
Celf5	A	G	10: 81,467,304		probably benign	Het
Cep290	T	A	10: 100,496,810	V257E	probably damaging	Het
Cntrob	T	C	11: 69,320,867	D177G	possibly damaging	Het
Copg2	A	T	6: 30,810,336	F658I	probably damaging	Het
Csmd3	T	C	15: 47,899,739	T1234A	probably damaging	Het
Dhx35	A	G	2: 158,806,437	T72A	probably damaging	Het
Dmrtc2	A	T	7: 24,874,367	H209L	possibly damaging	Het
Eml5	G	T	12: 98,852,704		probably null	Het
Evpl	T	C	11: 116,223,660	E1068G	possibly damaging	Het
Ezh2	A	G	6: 47,576,660	M41T	probably damaging	Het
Fmo3	A	G	1: 162,968,725	S93P	possibly damaging	Het
Gdi2	A	G	13: 3,560,018	Y213C	possibly damaging	Het
Gpr15	A	T	16: 58,718,558	I56K	probably benign	Het
Gria2	G	T	3: 80,691,338	S796R	probably benign	Het
Hectd4	T	A	5: 121,291,191		probably benign	Het
Hgfac	T	C	5: 35,042,850		probably benign	Het
Hspg2	C	T	4: 137,520,156	R1200W	probably damaging	Het
Ift52	G	A	2: 163,025,355	D78N	possibly damaging	Het
Iqca	C	A	1: 90,081,416	W415L	probably damaging	Het
Ism1	A	T	2: 139,746,043	K236N	probably damaging	Het
Itgb6	C	T	2: 60,672,644	W43*	probably null	Het
Kcnk18	T	A	19: 59,235,341	I306N	probably damaging	Het
Kctd8	T	C	5: 69,340,560	K248E	probably damaging	Het
Layn	T	A	9: 51,059,533	I237F	probably benign	Het
Lce3f	C	T	3: 92,992,941	P23L	unknown	Het
Lct	A	G	1: 128,300,301	F1152L	probably damaging	Het
Mxra8	T	C	4: 155,843,074	I413T	probably damaging	Het
Nedd9	A	G	13: 41,317,962	V187A	probably benign	Het
Net1	A	G	13: 3,887,642	L207P	probably damaging	Het
Neurod1	G	T	2: 79,454,437	P201T	probably benign	Het
Nlrp1b	A	G	11: 71,161,821	F927S	probably damaging	Het
Ntrk3	T	A	7: 78,356,041	H524L	possibly damaging	Het
Nup98	A	C	7: 102,134,937	S1063A	probably benign	Het
Olfr1036	G	A	2: 86,074,760	V7I	possibly damaging	Het
Olfr1333	T	A	4: 118,829,868	M191L	probably benign	Het
Olfr1447	C	A	19: 12,901,235	V182F	probably benign	Het
Olfr215	T	C	6: 116,582,964		probably benign	Het
Olfr657	G	A	7: 104,636,159	V162I	probably benign	Het
Olfr747	G	T	14: 50,681,166	P156Q	possibly damaging	Het
Pdzd2	G	A	15: 12,592,460	R33W	probably damaging	Het
Phf21a	G	A	2: 92,330,515	V243I	probably damaging	Het
Ppp1r12b	A	G	1: 134,893,348		probably null	Het
Rexo5	T	C	7: 119,845,411	V703A	probably benign	Het
Rgs4	A	G	1: 169,745,278	S30P	probably benign	Het
Rrnad1	A	G	3: 87,923,817	S404P	probably damaging	Het
Rxra	C	A	2: 27,756,244	D340E	probably damaging	Het
Samhd1	A	G	2: 157,107,547	V473A	probably benign	Het
Scn3a	T	A	2: 65,472,342	K1253N	probably damaging	Het
Scn7a	T	C	2: 66,680,955	N1207S	probably benign	Het
Sema4g	T	A	19: 44,999,242		probably null	Het
Sema5b	A	G	16: 35,660,324	K787R	probably benign	Het
Serpinc1	A	G	1: 160,989,647	N104D	probably benign	Het
Sfn	T	C	4: 133,601,231	H180R	probably damaging	Het
Slc22a6	G	T	19: 8,619,107		probably null	Het
Slc9a8	T	C	2: 167,457,358	S217P	probably benign	Het
Smc6	A	G	12: 11,309,269	N965D	probably benign	Het
Sod2	T	A	17: 13,015,032	I177N	probably damaging	Het
Sp4	A	T	12: 118,299,600	I237K	probably damaging	Het
Sulf2	T	C	2: 166,079,612	K697R	probably benign	Het
Svs4	A	T	2: 164,277,085	D110E	unknown	Het
Tas1r1	T	A	4: 152,038,218	R57*	probably null	Het
Tlr5	T	C	1: 182,973,722	I197T	probably damaging	Het
Tmc3	T	C	7: 83,612,532	V606A	probably benign	Het
Tmem241	T	A	18: 12,118,412	L37F	probably damaging	Het
Tmem59l	A	T	8: 70,486,253	N90K	probably damaging	Het
Tram1	A	C	1: 13,576,456		probably benign	Het
Trim15	T	A	17: 36,865,169	H162L	probably benign	Het
Ttc28	T	A	5: 111,276,811	Y1501N	probably benign	Het
Ttc34	T	C	4: 154,862,214	V857A	probably benign	Het
Tulp4	A	G	17: 6,139,046	T48A	probably damaging	Het
Usp9y	T	C	Y: 1,368,089	E939G	probably damaging	Het
Utp20	A	G	10: 88,770,808	I1634T	probably benign	Het
Vmn2r72	T	C	7: 85,738,170	M729V	probably benign	Het
Vps13c	C	T	9: 67,881,447	T334M	probably damaging	Het
Wnk4	C	G	11: 101,276,340		probably benign	Het
Xpo1	A	G	11: 23,271,193	N97D	probably benign	Het
Xpo4	A	T	14: 57,603,672	F518Y	probably benign	Het
Zfp668	C	T	7: 127,866,606	V469I	possibly damaging	Het
Zfp85	C	A	13: 67,749,704	C83F	probably damaging	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign
R9447:Sec24d	UTSW	3	123290513	missense	probably benign	0.00
R9701:Sec24d	UTSW	3	123269672	missense	probably damaging	1.00
R9758:Sec24d	UTSW	3	123343154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCATGGGAGGAGAGTCTCTG -3'
(R):5'- AACGATATTAATCAGCCAGTCTGC -3'

Sequencing Primer
(F):5'- AGAAAGTTCATGTCATAACGTGG -3'
(R):5'- GATATTAATCAGCCAGTCTGCTCAGC -3'

Posted On

2014-06-23