Incidental Mutation 'R1775:Tmc3'
ID204327
Institutional Source Beutler Lab
Gene Symbol Tmc3
Ensembl Gene ENSMUSG00000038540
Gene Nametransmembrane channel-like gene family 3
Synonyms
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83584927-83625614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83612532 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 606 (V606A)
Ref Sequence ENSEMBL: ENSMUSP00000130348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039317] [ENSMUST00000164944]
Predicted Effect probably benign
Transcript: ENSMUST00000039317
AA Change: V606A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046028
Gene: ENSMUSG00000038540
AA Change: V606A

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 5e-42 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1071 1089 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163297
Predicted Effect probably benign
Transcript: ENSMUST00000164944
AA Change: V606A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130348
Gene: ENSMUSG00000038540
AA Change: V606A

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 1.1e-45 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1042 1060 N/A INTRINSIC
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Tmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tmc3 APN 7 83603474 missense probably null 1.00
IGL01372:Tmc3 APN 7 83612538 missense probably damaging 1.00
IGL02072:Tmc3 APN 7 83615940 missense probably benign 0.00
IGL02168:Tmc3 APN 7 83619995 missense possibly damaging 0.87
IGL02344:Tmc3 APN 7 83609094 missense probably benign 0.00
IGL02421:Tmc3 APN 7 83622744 missense probably benign
IGL02604:Tmc3 APN 7 83622619 missense possibly damaging 0.85
IGL02863:Tmc3 APN 7 83622286 missense probably benign 0.04
IGL02863:Tmc3 APN 7 83622285 missense possibly damaging 0.61
IGL03058:Tmc3 APN 7 83615886 missense possibly damaging 0.91
IGL03303:Tmc3 APN 7 83590725 splice site probably benign
F5770:Tmc3 UTSW 7 83622505 missense probably benign 0.01
R0133:Tmc3 UTSW 7 83612473 missense probably damaging 1.00
R0147:Tmc3 UTSW 7 83607742 missense probably damaging 1.00
R0304:Tmc3 UTSW 7 83596139 missense probably damaging 1.00
R0320:Tmc3 UTSW 7 83607819 splice site probably benign
R0478:Tmc3 UTSW 7 83622152 missense possibly damaging 0.66
R0714:Tmc3 UTSW 7 83616761 missense possibly damaging 0.94
R1471:Tmc3 UTSW 7 83598290 missense probably damaging 1.00
R1725:Tmc3 UTSW 7 83604732 missense probably damaging 1.00
R2176:Tmc3 UTSW 7 83609308 missense probably damaging 1.00
R4001:Tmc3 UTSW 7 83620063 missense probably benign 0.01
R4229:Tmc3 UTSW 7 83597402 intron probably benign
R4635:Tmc3 UTSW 7 83585082 unclassified probably benign
R4715:Tmc3 UTSW 7 83622396 missense probably benign 0.05
R4789:Tmc3 UTSW 7 83622538 missense probably damaging 0.99
R4998:Tmc3 UTSW 7 83622321 missense probably benign 0.16
R5044:Tmc3 UTSW 7 83609118 missense probably benign 0.00
R5108:Tmc3 UTSW 7 83619948 missense probably damaging 0.97
R5119:Tmc3 UTSW 7 83615010 missense probably damaging 1.00
R5428:Tmc3 UTSW 7 83612547 missense probably damaging 1.00
R5447:Tmc3 UTSW 7 83622361 missense possibly damaging 0.63
R5767:Tmc3 UTSW 7 83599982 missense probably benign 0.43
R5801:Tmc3 UTSW 7 83622478 missense possibly damaging 0.94
R6115:Tmc3 UTSW 7 83614962 missense possibly damaging 0.47
R6193:Tmc3 UTSW 7 83603335 missense probably benign 0.26
R6436:Tmc3 UTSW 7 83598487 missense probably damaging 1.00
R6478:Tmc3 UTSW 7 83622316 missense probably benign 0.31
R6648:Tmc3 UTSW 7 83597543 missense probably damaging 1.00
R6849:Tmc3 UTSW 7 83586357 missense probably damaging 1.00
R7030:Tmc3 UTSW 7 83616817 splice site probably null
R7085:Tmc3 UTSW 7 83622145 missense possibly damaging 0.88
R7574:Tmc3 UTSW 7 83598273 missense probably damaging 0.99
R7685:Tmc3 UTSW 7 83597458 missense probably damaging 1.00
R7888:Tmc3 UTSW 7 83600009 missense probably damaging 1.00
R8474:Tmc3 UTSW 7 83609914 missense probably damaging 1.00
V7581:Tmc3 UTSW 7 83622505 missense probably benign 0.01
Z1088:Tmc3 UTSW 7 83603468 missense probably damaging 1.00
Z1188:Tmc3 UTSW 7 83612478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACACGGAATGTCTCACACC -3'
(R):5'- ACTCCAAAGGGGTGACAATTG -3'

Sequencing Primer
(F):5'- GGAATGTCTCACACCCTTGC -3'
(R):5'- CTCCAAAGGGGTGACAATTGATTTC -3'
Posted On2014-06-23