Incidental Mutation 'R1775:Vmn2r72'
ID204328
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85738170 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 729 (M729V)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: M729V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: M729V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACACCAGCATGCTGAATGTC -3'
(R):5'- CAGACCACTTTTGCCATTGC -3'

Sequencing Primer
(F):5'- CATGCTGAATGTCAAGAGCTTGGC -3'
(R):5'- ACCTCTACTATTTTGGCTAAGACG -3'
Posted On2014-06-23