Incidental Mutation 'R0111:Slc30a10'
ID20433
Institutional Source Beutler Lab
Gene Symbol Slc30a10
Ensembl Gene ENSMUSG00000026614
Gene Namesolute carrier family 30, member 10
Synonyms
MMRRC Submission 038397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0111 (G1)
Quality Score133
Status Validated (trace)
Chromosome1
Chromosomal Location185454848-185468762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 185455547 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 162 (R162S)
Ref Sequence ENSEMBL: ENSMUSP00000053181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061093]
Predicted Effect probably benign
Transcript: ENSMUST00000061093
AA Change: R162S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053181
Gene: ENSMUSG00000026614
AA Change: R162S

DomainStartEndE-ValueType
Pfam:Cation_efflux 11 299 2e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180623
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit post-weaning growth defects, increased manganese levels in the brain, blood, liver and thyroid gland, severe hypothyroidism and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A T 17: 55,817,073 H491L possibly damaging Het
Adgrg3 T C 8: 95,035,110 probably benign Het
Arhgap5 T C 12: 52,559,960 probably benign Het
Asic1 T C 15: 99,696,983 Y334H probably damaging Het
Calcr T A 6: 3,717,157 D101V probably damaging Het
Cdh2 A T 18: 16,774,509 N57K probably benign Het
Clec4d C A 6: 123,268,047 Y95* probably null Het
Cracr2a A G 6: 127,604,061 T67A probably benign Het
Dennd5a A T 7: 109,934,754 V53D probably damaging Het
Dnah7a T C 1: 53,468,684 D3076G probably benign Het
Espnl T C 1: 91,344,742 M608T probably benign Het
Fam149a C T 8: 45,341,146 probably benign Het
Fam35a T C 14: 34,267,729 K407E probably damaging Het
Fam46c T C 3: 100,472,786 D218G probably damaging Het
Flnc T C 6: 29,454,340 V1884A probably damaging Het
Helz2 A C 2: 181,237,802 S674R probably benign Het
Hoxa2 T G 6: 52,164,487 probably null Het
Ifi47 T A 11: 49,096,070 N221K probably damaging Het
Ipo9 A G 1: 135,405,924 V340A probably damaging Het
Kalrn A T 16: 34,031,590 N373K probably damaging Het
Kif26a T C 12: 112,163,337 probably benign Het
Kiss1r A G 10: 79,918,689 T6A possibly damaging Het
Lama1 A T 17: 67,737,498 I131F probably damaging Het
Nefm T C 14: 68,124,542 D91G probably benign Het
Nos3 C T 5: 24,372,704 T572I probably damaging Het
Notch2 T C 3: 98,138,761 F1710L probably benign Het
Olfr70 T C 4: 43,696,648 N175S probably damaging Het
Olfr804 T A 10: 129,705,277 I133N probably damaging Het
Ostm1 T C 10: 42,679,258 L92P probably damaging Het
Pcdh15 T A 10: 74,626,819 Y1445* probably null Het
Pde1b T C 15: 103,503,513 S14P probably benign Het
Pitpna T C 11: 75,625,484 V265A probably benign Het
Plec G T 15: 76,178,646 T2476K probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppp3cc C T 14: 70,256,359 probably null Het
Prss36 A G 7: 127,934,545 L530P probably damaging Het
Ptpn13 T C 5: 103,580,763 probably benign Het
Ptpn23 T C 9: 110,385,623 D1570G probably damaging Het
Rab42 T C 4: 132,302,365 D182G possibly damaging Het
Rbm27 T A 18: 42,305,672 probably benign Het
Rp1 T C 1: 4,344,760 E2043G probably damaging Het
Rufy3 C T 5: 88,630,584 S341F probably damaging Het
Samd9l C T 6: 3,374,946 V772I possibly damaging Het
Scaper A G 9: 55,602,790 M654T probably benign Het
Sipa1l3 G A 7: 29,348,318 P333S probably damaging Het
Spryd3 A T 15: 102,128,537 probably null Het
Tas2r110 T C 6: 132,868,203 F66L probably benign Het
Thap2 T C 10: 115,372,627 N196S probably benign Het
Themis2 C A 4: 132,789,925 R88L probably benign Het
Trip12 A T 1: 84,759,133 probably benign Het
Ube3b T A 5: 114,390,376 probably benign Het
Usp20 T A 2: 31,002,612 H64Q probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r15 T C 5: 109,287,156 R561G possibly damaging Het
Vsig10l A G 7: 43,468,101 D604G probably damaging Het
Wdr90 A G 17: 25,848,444 probably benign Het
Xirp2 A T 2: 67,508,378 N321I probably damaging Het
Zfp595 A G 13: 67,320,920 F11S possibly damaging Het
Zfp953 T A 13: 67,343,075 H271L probably damaging Het
Other mutations in Slc30a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Slc30a10 APN 1 185455419 missense probably damaging 1.00
IGL01779:Slc30a10 APN 1 185464179 missense possibly damaging 0.94
IGL01906:Slc30a10 APN 1 185456396 nonsense probably null
IGL02024:Slc30a10 APN 1 185455241 missense possibly damaging 0.94
R0133:Slc30a10 UTSW 1 185455173 missense probably damaging 1.00
R1886:Slc30a10 UTSW 1 185462864 missense probably damaging 1.00
R3915:Slc30a10 UTSW 1 185455136 nonsense probably null
R5597:Slc30a10 UTSW 1 185462700 missense probably damaging 1.00
R6175:Slc30a10 UTSW 1 185455311 missense probably damaging 1.00
R6669:Slc30a10 UTSW 1 185464428 missense probably benign
R8108:Slc30a10 UTSW 1 185464154 missense possibly damaging 0.90
R8345:Slc30a10 UTSW 1 185455467 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CAACATGCTGTCAGACCTGATCTCG -3'
(R):5'- GGAAGAACAAAGTGCTCCCAGTCC -3'

Sequencing Primer
(F):5'- GTCAGACCTGATCTCGCTGTG -3'
(R):5'- CGGAAGGATGCAACCGAAAG -3'
Posted On2013-04-11