Incidental Mutation 'R0111:Usp20'
ID 20434
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms Vdu2, 1700055M05Rik
MMRRC Submission 038397-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0111 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 2
Chromosomal Location 30872291-30912667 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30892624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 64 (H64Q)
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000125601] [ENSMUST00000128295] [ENSMUST00000138161] [ENSMUST00000170476] [ENSMUST00000142232]
AlphaFold Q8C6M1
Predicted Effect probably damaging
Transcript: ENSMUST00000061544
AA Change: H64Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854
AA Change: H64Q

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102849
AA Change: H64Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: H64Q

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125601
AA Change: H64Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121699
Gene: ENSMUSG00000026854
AA Change: H64Q

DomainStartEndE-ValueType
Pfam:zf-UBP 30 66 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128295
AA Change: H64Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115613
Gene: ENSMUSG00000026854
AA Change: H64Q

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136588
AA Change: H28Q
SMART Domains Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854
AA Change: H28Q

DomainStartEndE-ValueType
Pfam:zf-UBP 10 60 6.4e-12 PFAM
low complexity region 93 103 N/A INTRINSIC
Pfam:UCH 109 142 4.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138161
AA Change: H64Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116696
Gene: ENSMUSG00000026854
AA Change: H64Q

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170476
AA Change: H64Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: H64Q

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154634
Predicted Effect probably benign
Transcript: ENSMUST00000142232
SMART Domains Protein: ENSMUSP00000115347
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
PDB:2UZG|A 70 99 5e-8 PDB
Meta Mutation Damage Score 0.8787 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A T 17: 56,124,073 (GRCm39) H491L possibly damaging Het
Adgrg3 T C 8: 95,761,738 (GRCm39) probably benign Het
Arhgap5 T C 12: 52,606,743 (GRCm39) probably benign Het
Asic1 T C 15: 99,594,864 (GRCm39) Y334H probably damaging Het
Calcr T A 6: 3,717,157 (GRCm39) D101V probably damaging Het
Cdh2 A T 18: 16,907,566 (GRCm39) N57K probably benign Het
Clec4d C A 6: 123,245,006 (GRCm39) Y95* probably null Het
Cracr2a A G 6: 127,581,024 (GRCm39) T67A probably benign Het
Dennd5a A T 7: 109,533,961 (GRCm39) V53D probably damaging Het
Dnah7a T C 1: 53,507,843 (GRCm39) D3076G probably benign Het
Espnl T C 1: 91,272,464 (GRCm39) M608T probably benign Het
Fam149a C T 8: 45,794,183 (GRCm39) probably benign Het
Flnc T C 6: 29,454,339 (GRCm39) V1884A probably damaging Het
Helz2 A C 2: 180,879,595 (GRCm39) S674R probably benign Het
Hoxa2 T G 6: 52,141,467 (GRCm39) probably null Het
Ifi47 T A 11: 48,986,897 (GRCm39) N221K probably damaging Het
Ipo9 A G 1: 135,333,662 (GRCm39) V340A probably damaging Het
Kalrn A T 16: 33,851,960 (GRCm39) N373K probably damaging Het
Kif26a T C 12: 112,129,771 (GRCm39) probably benign Het
Kiss1r A G 10: 79,754,523 (GRCm39) T6A possibly damaging Het
Lama1 A T 17: 68,044,493 (GRCm39) I131F probably damaging Het
Nefm T C 14: 68,361,991 (GRCm39) D91G probably benign Het
Nos3 C T 5: 24,577,702 (GRCm39) T572I probably damaging Het
Notch2 T C 3: 98,046,077 (GRCm39) F1710L probably benign Het
Or13e8 T C 4: 43,696,648 (GRCm39) N175S probably damaging Het
Or6c6c T A 10: 129,541,146 (GRCm39) I133N probably damaging Het
Ostm1 T C 10: 42,555,254 (GRCm39) L92P probably damaging Het
Pcdh15 T A 10: 74,462,651 (GRCm39) Y1445* probably null Het
Pde1b T C 15: 103,411,940 (GRCm39) S14P probably benign Het
Pitpna T C 11: 75,516,310 (GRCm39) V265A probably benign Het
Plec G T 15: 76,062,846 (GRCm39) T2476K probably damaging Het
Pold2 A G 11: 5,826,760 (GRCm39) L58P probably damaging Het
Ppp3cc C T 14: 70,493,808 (GRCm39) probably null Het
Prss36 A G 7: 127,533,717 (GRCm39) L530P probably damaging Het
Ptpn13 T C 5: 103,728,629 (GRCm39) probably benign Het
Ptpn23 T C 9: 110,214,691 (GRCm39) D1570G probably damaging Het
Rab42 T C 4: 132,029,676 (GRCm39) D182G possibly damaging Het
Rbm27 T A 18: 42,438,737 (GRCm39) probably benign Het
Rp1 T C 1: 4,414,983 (GRCm39) E2043G probably damaging Het
Rufy3 C T 5: 88,778,443 (GRCm39) S341F probably damaging Het
Samd9l C T 6: 3,374,946 (GRCm39) V772I possibly damaging Het
Scaper A G 9: 55,510,074 (GRCm39) M654T probably benign Het
Shld2 T C 14: 33,989,686 (GRCm39) K407E probably damaging Het
Sipa1l3 G A 7: 29,047,743 (GRCm39) P333S probably damaging Het
Slc30a10 C A 1: 185,187,744 (GRCm39) R162S probably benign Het
Spryd3 A T 15: 102,036,972 (GRCm39) probably null Het
Tas2r110 T C 6: 132,845,166 (GRCm39) F66L probably benign Het
Tent5c T C 3: 100,380,102 (GRCm39) D218G probably damaging Het
Thap2 T C 10: 115,208,532 (GRCm39) N196S probably benign Het
Themis2 C A 4: 132,517,236 (GRCm39) R88L probably benign Het
Trip12 A T 1: 84,736,854 (GRCm39) probably benign Het
Ube3b T A 5: 114,528,437 (GRCm39) probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r15 T C 5: 109,435,022 (GRCm39) R561G possibly damaging Het
Vsig10l A G 7: 43,117,525 (GRCm39) D604G probably damaging Het
Wdr90 A G 17: 26,067,418 (GRCm39) probably benign Het
Xirp2 A T 2: 67,338,722 (GRCm39) N321I probably damaging Het
Zfp595 A G 13: 67,468,984 (GRCm39) F11S possibly damaging Het
Zfp953 T A 13: 67,491,139 (GRCm39) H271L probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 30,894,962 (GRCm39) missense probably damaging 1.00
IGL01444:Usp20 APN 2 30,888,801 (GRCm39) start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 30,901,806 (GRCm39) missense probably benign 0.04
IGL01785:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL01786:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL02129:Usp20 APN 2 30,894,462 (GRCm39) missense probably benign 0.43
IGL02147:Usp20 APN 2 30,896,413 (GRCm39) missense probably damaging 1.00
IGL03396:Usp20 APN 2 30,901,729 (GRCm39) missense probably benign
BB007:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
BB017:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 30,907,498 (GRCm39) missense possibly damaging 0.47
R0369:Usp20 UTSW 2 30,901,116 (GRCm39) missense probably benign 0.00
R0479:Usp20 UTSW 2 30,907,487 (GRCm39) missense probably benign 0.18
R0538:Usp20 UTSW 2 30,894,462 (GRCm39) missense probably damaging 0.99
R1023:Usp20 UTSW 2 30,897,825 (GRCm39) missense probably damaging 1.00
R1183:Usp20 UTSW 2 30,901,797 (GRCm39) missense probably benign 0.17
R1635:Usp20 UTSW 2 30,908,830 (GRCm39) missense probably benign 0.03
R2114:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2115:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2116:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2117:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2232:Usp20 UTSW 2 30,908,750 (GRCm39) missense probably benign 0.13
R2244:Usp20 UTSW 2 30,900,343 (GRCm39) missense possibly damaging 0.65
R2883:Usp20 UTSW 2 30,908,812 (GRCm39) missense probably benign
R4734:Usp20 UTSW 2 30,909,836 (GRCm39) missense probably benign 0.31
R5507:Usp20 UTSW 2 30,900,238 (GRCm39) missense probably benign
R5770:Usp20 UTSW 2 30,907,520 (GRCm39) missense probably damaging 1.00
R5862:Usp20 UTSW 2 30,896,461 (GRCm39) nonsense probably null
R6315:Usp20 UTSW 2 30,907,770 (GRCm39) missense possibly damaging 0.70
R7603:Usp20 UTSW 2 30,901,486 (GRCm39) missense probably damaging 1.00
R7887:Usp20 UTSW 2 30,910,906 (GRCm39) missense probably benign 0.34
R7930:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
R8542:Usp20 UTSW 2 30,901,636 (GRCm39) missense possibly damaging 0.94
R8965:Usp20 UTSW 2 30,901,797 (GRCm39) missense possibly damaging 0.77
R9079:Usp20 UTSW 2 30,895,120 (GRCm39) intron probably benign
R9226:Usp20 UTSW 2 30,907,412 (GRCm39) missense probably damaging 0.99
R9417:Usp20 UTSW 2 30,873,030 (GRCm39) critical splice acceptor site probably null
R9459:Usp20 UTSW 2 30,901,024 (GRCm39) missense probably damaging 0.99
Z1176:Usp20 UTSW 2 30,909,830 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGATAGCAGCAAGTCACACTGCC -3'
(R):5'- CTGCTCCAGAAAGACTTCACGCTC -3'

Sequencing Primer
(F):5'- ACACTGCCTTGGGCTAGAG -3'
(R):5'- AACGTGGTCAGGTTCACAGTC -3'
Posted On 2013-04-11