Incidental Mutation 'R1775:Pdzd2'
ID 204364
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene Name PDZ domain containing 2
Synonyms Gm21706, A930022H17Rik, Pdzk3, 4930537L06Rik, LOC223364
MMRRC Submission 039806-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1775 (G1)
Quality Score 147
Status Validated
Chromosome 15
Chromosomal Location 12359797-12740010 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12592546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 33 (R33W)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075317
AA Change: R33W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: R33W

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189746
Meta Mutation Damage Score 0.2271 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,272,143 (GRCm39) S20P unknown Het
4921528I07Rik G A 9: 114,108,386 (GRCm39) noncoding transcript Het
4930562C15Rik G A 16: 4,669,422 (GRCm39) probably null Het
4933427I04Rik A G 4: 123,754,286 (GRCm39) T67A possibly damaging Het
Abcc2 A T 19: 43,786,858 (GRCm39) N160Y possibly damaging Het
Acaca A G 11: 84,191,248 (GRCm39) D155G possibly damaging Het
Afg3l1 G A 8: 124,219,639 (GRCm39) R389Q possibly damaging Het
Ank2 G A 3: 126,728,196 (GRCm39) T799M probably benign Het
Anxa2 T C 9: 69,395,363 (GRCm39) Y202H possibly damaging Het
Arhgef33 A G 17: 80,681,172 (GRCm39) T771A probably benign Het
Atp12a T C 14: 56,610,046 (GRCm39) V182A probably benign Het
Birc6 T C 17: 74,919,281 (GRCm39) L210S probably damaging Het
Car3 A G 3: 14,929,492 (GRCm39) T73A probably benign Het
Cd5l T C 3: 87,275,966 (GRCm39) L312P probably damaging Het
Celf5 A G 10: 81,303,138 (GRCm39) probably benign Het
Cep290 T A 10: 100,332,672 (GRCm39) V257E probably damaging Het
Cntrob T C 11: 69,211,693 (GRCm39) D177G possibly damaging Het
Copg2 A T 6: 30,787,271 (GRCm39) F658I probably damaging Het
Csmd3 T C 15: 47,763,135 (GRCm39) T1234A probably damaging Het
Dhx35 A G 2: 158,648,357 (GRCm39) T72A probably damaging Het
Dmrtc2 A T 7: 24,573,792 (GRCm39) H209L possibly damaging Het
Eml5 G T 12: 98,818,963 (GRCm39) probably null Het
Evpl T C 11: 116,114,486 (GRCm39) E1068G possibly damaging Het
Ezh2 A G 6: 47,553,594 (GRCm39) M41T probably damaging Het
Fmo3 A G 1: 162,796,294 (GRCm39) S93P possibly damaging Het
Gdi2 A G 13: 3,610,018 (GRCm39) Y213C possibly damaging Het
Gpr15 A T 16: 58,538,921 (GRCm39) I56K probably benign Het
Gria2 G T 3: 80,598,645 (GRCm39) S796R probably benign Het
Hectd4 T A 5: 121,429,254 (GRCm39) probably benign Het
Hgfac T C 5: 35,200,194 (GRCm39) probably benign Het
Hspg2 C T 4: 137,247,467 (GRCm39) R1200W probably damaging Het
Ift52 G A 2: 162,867,275 (GRCm39) D78N possibly damaging Het
Iqca1 C A 1: 90,009,138 (GRCm39) W415L probably damaging Het
Ism1 A T 2: 139,587,963 (GRCm39) K236N probably damaging Het
Itgb6 C T 2: 60,502,988 (GRCm39) W43* probably null Het
Kcnk18 T A 19: 59,223,773 (GRCm39) I306N probably damaging Het
Kctd8 T C 5: 69,497,903 (GRCm39) K248E probably damaging Het
Layn T A 9: 50,970,833 (GRCm39) I237F probably benign Het
Lce3f C T 3: 92,900,248 (GRCm39) P23L unknown Het
Lct A G 1: 128,228,038 (GRCm39) F1152L probably damaging Het
Mettl25b A G 3: 87,831,124 (GRCm39) S404P probably damaging Het
Mxra8 T C 4: 155,927,531 (GRCm39) I413T probably damaging Het
Nedd9 A G 13: 41,471,438 (GRCm39) V187A probably benign Het
Net1 A G 13: 3,937,642 (GRCm39) L207P probably damaging Het
Neurod1 G T 2: 79,284,781 (GRCm39) P201T probably benign Het
Nlrp1b A G 11: 71,052,647 (GRCm39) F927S probably damaging Het
Ntrk3 T A 7: 78,005,789 (GRCm39) H524L possibly damaging Het
Nup98 A C 7: 101,784,144 (GRCm39) S1063A probably benign Het
Or10ak11 T A 4: 118,687,065 (GRCm39) M191L probably benign Het
Or11h4b G T 14: 50,918,623 (GRCm39) P156Q possibly damaging Het
Or56b1 G A 7: 104,285,366 (GRCm39) V162I probably benign Het
Or5b97 C A 19: 12,878,599 (GRCm39) V182F probably benign Het
Or5m9b G A 2: 85,905,104 (GRCm39) V7I possibly damaging Het
Or6d15 T C 6: 116,559,925 (GRCm39) probably benign Het
Phf21a G A 2: 92,160,860 (GRCm39) V243I probably damaging Het
Ppp1r12b A G 1: 134,821,086 (GRCm39) probably null Het
Rexo5 T C 7: 119,444,634 (GRCm39) V703A probably benign Het
Rgs4 A G 1: 169,572,847 (GRCm39) S30P probably benign Het
Rxra C A 2: 27,646,256 (GRCm39) D340E probably damaging Het
Samhd1 A G 2: 156,949,467 (GRCm39) V473A probably benign Het
Scn3a T A 2: 65,302,686 (GRCm39) K1253N probably damaging Het
Scn7a T C 2: 66,511,299 (GRCm39) N1207S probably benign Het
Sec24d T A 3: 123,130,166 (GRCm39) I443N probably damaging Het
Sema4g T A 19: 44,987,681 (GRCm39) probably null Het
Sema5b A G 16: 35,480,694 (GRCm39) K787R probably benign Het
Serpinc1 A G 1: 160,817,217 (GRCm39) N104D probably benign Het
Sfn T C 4: 133,328,542 (GRCm39) H180R probably damaging Het
Slc22a6 G T 19: 8,596,471 (GRCm39) probably null Het
Slc9a8 T C 2: 167,299,278 (GRCm39) S217P probably benign Het
Smc6 A G 12: 11,359,270 (GRCm39) N965D probably benign Het
Sod2 T A 17: 13,233,919 (GRCm39) I177N probably damaging Het
Sp4 A T 12: 118,263,335 (GRCm39) I237K probably damaging Het
Sulf2 T C 2: 165,921,532 (GRCm39) K697R probably benign Het
Svs4 A T 2: 164,119,005 (GRCm39) D110E unknown Het
Tas1r1 T A 4: 152,122,675 (GRCm39) R57* probably null Het
Tlr5 T C 1: 182,801,287 (GRCm39) I197T probably damaging Het
Tmc3 T C 7: 83,261,740 (GRCm39) V606A probably benign Het
Tmem241 T A 18: 12,251,469 (GRCm39) L37F probably damaging Het
Tmem59l A T 8: 70,938,903 (GRCm39) N90K probably damaging Het
Tram1 A C 1: 13,646,680 (GRCm39) probably benign Het
Trim15 T A 17: 37,176,061 (GRCm39) H162L probably benign Het
Ttc28 T A 5: 111,424,677 (GRCm39) Y1501N probably benign Het
Ttc34 T C 4: 154,946,671 (GRCm39) V857A probably benign Het
Tulp4 A G 17: 6,189,321 (GRCm39) T48A probably damaging Het
Usp9y T C Y: 1,368,089 (GRCm39) E939G probably damaging Het
Utp20 A G 10: 88,606,670 (GRCm39) I1634T probably benign Het
Vmn2r72 T C 7: 85,387,378 (GRCm39) M729V probably benign Het
Vps13c C T 9: 67,788,729 (GRCm39) T334M probably damaging Het
Wnk4 C G 11: 101,167,166 (GRCm39) probably benign Het
Xpo1 A G 11: 23,221,193 (GRCm39) N97D probably benign Het
Xpo4 A T 14: 57,841,129 (GRCm39) F518Y probably benign Het
Zfp668 C T 7: 127,465,778 (GRCm39) V469I possibly damaging Het
Zfp85 C A 13: 67,897,823 (GRCm39) C83F probably damaging Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12,458,069 (GRCm39) missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12,365,853 (GRCm39) splice site probably null
IGL00697:Pdzd2 APN 15 12,373,733 (GRCm39) missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12,374,498 (GRCm39) missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12,374,804 (GRCm39) missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12,402,718 (GRCm39) unclassified probably benign
IGL01389:Pdzd2 APN 15 12,374,712 (GRCm39) missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12,458,293 (GRCm39) missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12,445,750 (GRCm39) missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12,592,569 (GRCm39) missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12,372,632 (GRCm39) missense probably benign
IGL01915:Pdzd2 APN 15 12,371,725 (GRCm39) missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12,592,440 (GRCm39) missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12,376,382 (GRCm39) missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12,445,735 (GRCm39) missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12,375,851 (GRCm39) missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12,411,105 (GRCm39) missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12,385,720 (GRCm39) missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12,592,329 (GRCm39) missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12,376,113 (GRCm39) missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12,374,427 (GRCm39) missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12,382,708 (GRCm39) missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12,385,351 (GRCm39) missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12,388,628 (GRCm39) critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12,373,850 (GRCm39) missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12,399,374 (GRCm39) missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12,371,691 (GRCm39) missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12,368,027 (GRCm39) missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12,368,027 (GRCm39) missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12,375,110 (GRCm39) missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12,592,246 (GRCm39) missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12,592,364 (GRCm39) missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12,376,385 (GRCm39) missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12,458,144 (GRCm39) missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12,399,356 (GRCm39) missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12,374,594 (GRCm39) missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12,371,725 (GRCm39) missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12,390,052 (GRCm39) critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12,373,173 (GRCm39) missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12,457,981 (GRCm39) missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12,458,306 (GRCm39) missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12,385,525 (GRCm39) missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12,411,108 (GRCm39) missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12,373,915 (GRCm39) missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12,373,047 (GRCm39) missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12,385,950 (GRCm39) missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12,387,740 (GRCm39) missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12,390,134 (GRCm39) missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12,373,941 (GRCm39) missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12,457,972 (GRCm39) missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12,373,986 (GRCm39) missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12,373,676 (GRCm39) missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12,406,645 (GRCm39) missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12,375,879 (GRCm39) missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12,373,934 (GRCm39) missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12,373,247 (GRCm39) missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12,375,557 (GRCm39) missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12,376,262 (GRCm39) missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12,375,594 (GRCm39) missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12,387,732 (GRCm39) missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12,376,061 (GRCm39) missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12,385,723 (GRCm39) missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12,385,723 (GRCm39) missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12,419,567 (GRCm39) missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12,385,797 (GRCm39) missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12,419,602 (GRCm39) missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12,374,681 (GRCm39) missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12,385,429 (GRCm39) missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12,375,734 (GRCm39) missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12,375,734 (GRCm39) missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12,592,494 (GRCm39) nonsense probably null
R5174:Pdzd2 UTSW 15 12,372,600 (GRCm39) missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12,390,119 (GRCm39) missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12,373,028 (GRCm39) missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12,592,263 (GRCm39) missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12,382,762 (GRCm39) missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12,382,762 (GRCm39) missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12,374,367 (GRCm39) missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12,592,436 (GRCm39) nonsense probably null
R5704:Pdzd2 UTSW 15 12,385,761 (GRCm39) missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12,442,675 (GRCm39) missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12,592,656 (GRCm39) splice site probably null
R6222:Pdzd2 UTSW 15 12,374,652 (GRCm39) missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12,458,274 (GRCm39) missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12,592,551 (GRCm39) missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12,385,951 (GRCm39) missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12,374,123 (GRCm39) missense probably benign
R6955:Pdzd2 UTSW 15 12,401,550 (GRCm39) missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12,375,993 (GRCm39) missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12,457,945 (GRCm39) missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12,373,061 (GRCm39) missense probably benign 0.14
R7014:Pdzd2 UTSW 15 12,372,647 (GRCm39) missense probably benign 0.13
R7110:Pdzd2 UTSW 15 12,368,099 (GRCm39) missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12,376,209 (GRCm39) missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12,458,231 (GRCm39) nonsense probably null
R7228:Pdzd2 UTSW 15 12,373,059 (GRCm39) missense probably benign 0.01
R7317:Pdzd2 UTSW 15 12,592,329 (GRCm39) missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12,437,248 (GRCm39) missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12,399,291 (GRCm39) missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12,372,820 (GRCm39) missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12,373,289 (GRCm39) missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12,407,422 (GRCm39) missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12,373,460 (GRCm39) missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12,374,102 (GRCm39) missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12,385,872 (GRCm39) missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12,373,122 (GRCm39) missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12,373,122 (GRCm39) missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12,407,458 (GRCm39) missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12,592,249 (GRCm39) missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12,375,995 (GRCm39) missense probably benign
R8768:Pdzd2 UTSW 15 12,437,252 (GRCm39) missense probably damaging 1.00
R8879:Pdzd2 UTSW 15 12,402,405 (GRCm39) missense probably damaging 1.00
R9019:Pdzd2 UTSW 15 12,375,612 (GRCm39) missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12,374,385 (GRCm39) missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12,374,753 (GRCm39) missense possibly damaging 0.94
R9302:Pdzd2 UTSW 15 12,374,342 (GRCm39) missense possibly damaging 0.61
R9321:Pdzd2 UTSW 15 12,386,023 (GRCm39) missense probably benign 0.00
R9421:Pdzd2 UTSW 15 12,375,114 (GRCm39) missense
R9515:Pdzd2 UTSW 15 12,374,621 (GRCm39) missense probably damaging 1.00
R9592:Pdzd2 UTSW 15 12,458,106 (GRCm39) missense probably damaging 1.00
R9614:Pdzd2 UTSW 15 12,375,486 (GRCm39) missense probably damaging 1.00
R9630:Pdzd2 UTSW 15 12,374,443 (GRCm39) missense probably benign 0.37
R9776:Pdzd2 UTSW 15 12,457,909 (GRCm39) missense probably benign 0.03
X0057:Pdzd2 UTSW 15 12,411,113 (GRCm39) missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12,368,805 (GRCm39) missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12,372,942 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGAAAACAGGGATGTTGC -3'
(R):5'- GCCTGAACATGAACATGGGC -3'

Sequencing Primer
(F):5'- GGATGTTGCCAAAACTGAGCCC -3'
(R):5'- AGCTGATGATTGGGAGCCTTTCC -3'
Posted On 2014-06-23