Incidental Mutation 'R1775:Trim15'
ID 204373
Institutional Source Beutler Lab
Gene Symbol Trim15
Ensembl Gene ENSMUSG00000050747
Gene Name tripartite motif-containing 15
Synonyms 1810012B10Rik
MMRRC Submission 039806-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R1775 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 37171583-37178102 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37176061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 162 (H162L)
Ref Sequence ENSEMBL: ENSMUSP00000133953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025329] [ENSMUST00000060524] [ENSMUST00000174195]
AlphaFold G3UY57
Predicted Effect probably benign
Transcript: ENSMUST00000025329
AA Change: H162L

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025329
Gene: ENSMUSG00000050747
AA Change: H162L

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060524
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173639
AA Change: H43L
SMART Domains Protein: ENSMUSP00000133638
Gene: ENSMUSG00000050747
AA Change: H43L

DomainStartEndE-ValueType
SCOP:d1dkza_ 15 105 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174195
AA Change: H162L

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133953
Gene: ENSMUSG00000050747
AA Change: H162L

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Meta Mutation Damage Score 0.1178 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,272,143 (GRCm39) S20P unknown Het
4921528I07Rik G A 9: 114,108,386 (GRCm39) noncoding transcript Het
4930562C15Rik G A 16: 4,669,422 (GRCm39) probably null Het
4933427I04Rik A G 4: 123,754,286 (GRCm39) T67A possibly damaging Het
Abcc2 A T 19: 43,786,858 (GRCm39) N160Y possibly damaging Het
Acaca A G 11: 84,191,248 (GRCm39) D155G possibly damaging Het
Afg3l1 G A 8: 124,219,639 (GRCm39) R389Q possibly damaging Het
Ank2 G A 3: 126,728,196 (GRCm39) T799M probably benign Het
Anxa2 T C 9: 69,395,363 (GRCm39) Y202H possibly damaging Het
Arhgef33 A G 17: 80,681,172 (GRCm39) T771A probably benign Het
Atp12a T C 14: 56,610,046 (GRCm39) V182A probably benign Het
Birc6 T C 17: 74,919,281 (GRCm39) L210S probably damaging Het
Car3 A G 3: 14,929,492 (GRCm39) T73A probably benign Het
Cd5l T C 3: 87,275,966 (GRCm39) L312P probably damaging Het
Celf5 A G 10: 81,303,138 (GRCm39) probably benign Het
Cep290 T A 10: 100,332,672 (GRCm39) V257E probably damaging Het
Cntrob T C 11: 69,211,693 (GRCm39) D177G possibly damaging Het
Copg2 A T 6: 30,787,271 (GRCm39) F658I probably damaging Het
Csmd3 T C 15: 47,763,135 (GRCm39) T1234A probably damaging Het
Dhx35 A G 2: 158,648,357 (GRCm39) T72A probably damaging Het
Dmrtc2 A T 7: 24,573,792 (GRCm39) H209L possibly damaging Het
Eml5 G T 12: 98,818,963 (GRCm39) probably null Het
Evpl T C 11: 116,114,486 (GRCm39) E1068G possibly damaging Het
Ezh2 A G 6: 47,553,594 (GRCm39) M41T probably damaging Het
Fmo3 A G 1: 162,796,294 (GRCm39) S93P possibly damaging Het
Gdi2 A G 13: 3,610,018 (GRCm39) Y213C possibly damaging Het
Gpr15 A T 16: 58,538,921 (GRCm39) I56K probably benign Het
Gria2 G T 3: 80,598,645 (GRCm39) S796R probably benign Het
Hectd4 T A 5: 121,429,254 (GRCm39) probably benign Het
Hgfac T C 5: 35,200,194 (GRCm39) probably benign Het
Hspg2 C T 4: 137,247,467 (GRCm39) R1200W probably damaging Het
Ift52 G A 2: 162,867,275 (GRCm39) D78N possibly damaging Het
Iqca1 C A 1: 90,009,138 (GRCm39) W415L probably damaging Het
Ism1 A T 2: 139,587,963 (GRCm39) K236N probably damaging Het
Itgb6 C T 2: 60,502,988 (GRCm39) W43* probably null Het
Kcnk18 T A 19: 59,223,773 (GRCm39) I306N probably damaging Het
Kctd8 T C 5: 69,497,903 (GRCm39) K248E probably damaging Het
Layn T A 9: 50,970,833 (GRCm39) I237F probably benign Het
Lce3f C T 3: 92,900,248 (GRCm39) P23L unknown Het
Lct A G 1: 128,228,038 (GRCm39) F1152L probably damaging Het
Mettl25b A G 3: 87,831,124 (GRCm39) S404P probably damaging Het
Mxra8 T C 4: 155,927,531 (GRCm39) I413T probably damaging Het
Nedd9 A G 13: 41,471,438 (GRCm39) V187A probably benign Het
Net1 A G 13: 3,937,642 (GRCm39) L207P probably damaging Het
Neurod1 G T 2: 79,284,781 (GRCm39) P201T probably benign Het
Nlrp1b A G 11: 71,052,647 (GRCm39) F927S probably damaging Het
Ntrk3 T A 7: 78,005,789 (GRCm39) H524L possibly damaging Het
Nup98 A C 7: 101,784,144 (GRCm39) S1063A probably benign Het
Or10ak11 T A 4: 118,687,065 (GRCm39) M191L probably benign Het
Or11h4b G T 14: 50,918,623 (GRCm39) P156Q possibly damaging Het
Or56b1 G A 7: 104,285,366 (GRCm39) V162I probably benign Het
Or5b97 C A 19: 12,878,599 (GRCm39) V182F probably benign Het
Or5m9b G A 2: 85,905,104 (GRCm39) V7I possibly damaging Het
Or6d15 T C 6: 116,559,925 (GRCm39) probably benign Het
Pdzd2 G A 15: 12,592,546 (GRCm39) R33W probably damaging Het
Phf21a G A 2: 92,160,860 (GRCm39) V243I probably damaging Het
Ppp1r12b A G 1: 134,821,086 (GRCm39) probably null Het
Rexo5 T C 7: 119,444,634 (GRCm39) V703A probably benign Het
Rgs4 A G 1: 169,572,847 (GRCm39) S30P probably benign Het
Rxra C A 2: 27,646,256 (GRCm39) D340E probably damaging Het
Samhd1 A G 2: 156,949,467 (GRCm39) V473A probably benign Het
Scn3a T A 2: 65,302,686 (GRCm39) K1253N probably damaging Het
Scn7a T C 2: 66,511,299 (GRCm39) N1207S probably benign Het
Sec24d T A 3: 123,130,166 (GRCm39) I443N probably damaging Het
Sema4g T A 19: 44,987,681 (GRCm39) probably null Het
Sema5b A G 16: 35,480,694 (GRCm39) K787R probably benign Het
Serpinc1 A G 1: 160,817,217 (GRCm39) N104D probably benign Het
Sfn T C 4: 133,328,542 (GRCm39) H180R probably damaging Het
Slc22a6 G T 19: 8,596,471 (GRCm39) probably null Het
Slc9a8 T C 2: 167,299,278 (GRCm39) S217P probably benign Het
Smc6 A G 12: 11,359,270 (GRCm39) N965D probably benign Het
Sod2 T A 17: 13,233,919 (GRCm39) I177N probably damaging Het
Sp4 A T 12: 118,263,335 (GRCm39) I237K probably damaging Het
Sulf2 T C 2: 165,921,532 (GRCm39) K697R probably benign Het
Svs4 A T 2: 164,119,005 (GRCm39) D110E unknown Het
Tas1r1 T A 4: 152,122,675 (GRCm39) R57* probably null Het
Tlr5 T C 1: 182,801,287 (GRCm39) I197T probably damaging Het
Tmc3 T C 7: 83,261,740 (GRCm39) V606A probably benign Het
Tmem241 T A 18: 12,251,469 (GRCm39) L37F probably damaging Het
Tmem59l A T 8: 70,938,903 (GRCm39) N90K probably damaging Het
Tram1 A C 1: 13,646,680 (GRCm39) probably benign Het
Ttc28 T A 5: 111,424,677 (GRCm39) Y1501N probably benign Het
Ttc34 T C 4: 154,946,671 (GRCm39) V857A probably benign Het
Tulp4 A G 17: 6,189,321 (GRCm39) T48A probably damaging Het
Usp9y T C Y: 1,368,089 (GRCm39) E939G probably damaging Het
Utp20 A G 10: 88,606,670 (GRCm39) I1634T probably benign Het
Vmn2r72 T C 7: 85,387,378 (GRCm39) M729V probably benign Het
Vps13c C T 9: 67,788,729 (GRCm39) T334M probably damaging Het
Wnk4 C G 11: 101,167,166 (GRCm39) probably benign Het
Xpo1 A G 11: 23,221,193 (GRCm39) N97D probably benign Het
Xpo4 A T 14: 57,841,129 (GRCm39) F518Y probably benign Het
Zfp668 C T 7: 127,465,778 (GRCm39) V469I possibly damaging Het
Zfp85 C A 13: 67,897,823 (GRCm39) C83F probably damaging Het
Other mutations in Trim15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Trim15 APN 17 37,175,975 (GRCm39) missense probably damaging 0.97
IGL02135:Trim15 APN 17 37,177,956 (GRCm39) missense probably benign 0.00
IGL03024:Trim15 APN 17 37,177,785 (GRCm39) missense probably damaging 1.00
R0310:Trim15 UTSW 17 37,177,878 (GRCm39) missense probably damaging 1.00
R0490:Trim15 UTSW 17 37,177,247 (GRCm39) missense probably benign
R0992:Trim15 UTSW 17 37,175,903 (GRCm39) missense probably damaging 0.98
R1957:Trim15 UTSW 17 37,173,215 (GRCm39) unclassified probably benign
R3625:Trim15 UTSW 17 37,177,768 (GRCm39) missense possibly damaging 0.74
R4520:Trim15 UTSW 17 37,177,242 (GRCm39) missense probably benign 0.01
R4845:Trim15 UTSW 17 37,177,875 (GRCm39) missense probably benign 0.00
R5644:Trim15 UTSW 17 37,177,713 (GRCm39) missense probably damaging 0.99
R5838:Trim15 UTSW 17 37,173,732 (GRCm39) missense probably damaging 1.00
R5930:Trim15 UTSW 17 37,173,252 (GRCm39) critical splice acceptor site probably null
R6758:Trim15 UTSW 17 37,173,233 (GRCm39) missense probably benign 0.16
R7094:Trim15 UTSW 17 37,173,788 (GRCm39) missense probably benign
R7849:Trim15 UTSW 17 37,177,764 (GRCm39) missense probably benign 0.31
R9360:Trim15 UTSW 17 37,177,942 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGCTGGTTGCTGACAC -3'
(R):5'- ATCTCTGGCTAAGACAACAGC -3'

Sequencing Primer
(F):5'- GCTGGTTGCTGACACTTCTC -3'
(R):5'- TCAGAGCTCATCATCTGCAAGTG -3'
Posted On 2014-06-23