Incidental Mutation 'R1775:Birc6'
ID 204374
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Name baculoviral IAP repeat-containing 6
Synonyms D630005A10Rik, A430032G04Rik, apollon, Bruce, A430040A19Rik
MMRRC Submission 039806-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1775 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 74835290-75010351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74919281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 210 (L210S)
Ref Sequence ENSEMBL: ENSMUSP00000138717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182278] [ENSMUST00000182845] [ENSMUST00000183224] [ENSMUST00000182597] [ENSMUST00000182944]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000177957
AA Change: L730S
Predicted Effect probably damaging
Transcript: ENSMUST00000180037
AA Change: L2037S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: L2037S

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181387
Predicted Effect probably damaging
Transcript: ENSMUST00000182133
AA Change: L2037S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: L2037S

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182221
Predicted Effect probably damaging
Transcript: ENSMUST00000182278
AA Change: L123S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138343
Gene: ENSMUSG00000024073
AA Change: L123S

DomainStartEndE-ValueType
low complexity region 79 84 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
low complexity region 222 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182845
AA Change: L210S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138717
Gene: ENSMUSG00000024073
AA Change: L210S

DomainStartEndE-ValueType
low complexity region 166 171 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
low complexity region 315 336 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183224
AA Change: L2023S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: L2023S

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182597
AA Change: L2037S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: L2037S

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182944
AA Change: L2033S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: L2033S

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Meta Mutation Damage Score 0.7931 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,272,143 (GRCm39) S20P unknown Het
4921528I07Rik G A 9: 114,108,386 (GRCm39) noncoding transcript Het
4930562C15Rik G A 16: 4,669,422 (GRCm39) probably null Het
4933427I04Rik A G 4: 123,754,286 (GRCm39) T67A possibly damaging Het
Abcc2 A T 19: 43,786,858 (GRCm39) N160Y possibly damaging Het
Acaca A G 11: 84,191,248 (GRCm39) D155G possibly damaging Het
Afg3l1 G A 8: 124,219,639 (GRCm39) R389Q possibly damaging Het
Ank2 G A 3: 126,728,196 (GRCm39) T799M probably benign Het
Anxa2 T C 9: 69,395,363 (GRCm39) Y202H possibly damaging Het
Arhgef33 A G 17: 80,681,172 (GRCm39) T771A probably benign Het
Atp12a T C 14: 56,610,046 (GRCm39) V182A probably benign Het
Car3 A G 3: 14,929,492 (GRCm39) T73A probably benign Het
Cd5l T C 3: 87,275,966 (GRCm39) L312P probably damaging Het
Celf5 A G 10: 81,303,138 (GRCm39) probably benign Het
Cep290 T A 10: 100,332,672 (GRCm39) V257E probably damaging Het
Cntrob T C 11: 69,211,693 (GRCm39) D177G possibly damaging Het
Copg2 A T 6: 30,787,271 (GRCm39) F658I probably damaging Het
Csmd3 T C 15: 47,763,135 (GRCm39) T1234A probably damaging Het
Dhx35 A G 2: 158,648,357 (GRCm39) T72A probably damaging Het
Dmrtc2 A T 7: 24,573,792 (GRCm39) H209L possibly damaging Het
Eml5 G T 12: 98,818,963 (GRCm39) probably null Het
Evpl T C 11: 116,114,486 (GRCm39) E1068G possibly damaging Het
Ezh2 A G 6: 47,553,594 (GRCm39) M41T probably damaging Het
Fmo3 A G 1: 162,796,294 (GRCm39) S93P possibly damaging Het
Gdi2 A G 13: 3,610,018 (GRCm39) Y213C possibly damaging Het
Gpr15 A T 16: 58,538,921 (GRCm39) I56K probably benign Het
Gria2 G T 3: 80,598,645 (GRCm39) S796R probably benign Het
Hectd4 T A 5: 121,429,254 (GRCm39) probably benign Het
Hgfac T C 5: 35,200,194 (GRCm39) probably benign Het
Hspg2 C T 4: 137,247,467 (GRCm39) R1200W probably damaging Het
Ift52 G A 2: 162,867,275 (GRCm39) D78N possibly damaging Het
Iqca1 C A 1: 90,009,138 (GRCm39) W415L probably damaging Het
Ism1 A T 2: 139,587,963 (GRCm39) K236N probably damaging Het
Itgb6 C T 2: 60,502,988 (GRCm39) W43* probably null Het
Kcnk18 T A 19: 59,223,773 (GRCm39) I306N probably damaging Het
Kctd8 T C 5: 69,497,903 (GRCm39) K248E probably damaging Het
Layn T A 9: 50,970,833 (GRCm39) I237F probably benign Het
Lce3f C T 3: 92,900,248 (GRCm39) P23L unknown Het
Lct A G 1: 128,228,038 (GRCm39) F1152L probably damaging Het
Mettl25b A G 3: 87,831,124 (GRCm39) S404P probably damaging Het
Mxra8 T C 4: 155,927,531 (GRCm39) I413T probably damaging Het
Nedd9 A G 13: 41,471,438 (GRCm39) V187A probably benign Het
Net1 A G 13: 3,937,642 (GRCm39) L207P probably damaging Het
Neurod1 G T 2: 79,284,781 (GRCm39) P201T probably benign Het
Nlrp1b A G 11: 71,052,647 (GRCm39) F927S probably damaging Het
Ntrk3 T A 7: 78,005,789 (GRCm39) H524L possibly damaging Het
Nup98 A C 7: 101,784,144 (GRCm39) S1063A probably benign Het
Or10ak11 T A 4: 118,687,065 (GRCm39) M191L probably benign Het
Or11h4b G T 14: 50,918,623 (GRCm39) P156Q possibly damaging Het
Or56b1 G A 7: 104,285,366 (GRCm39) V162I probably benign Het
Or5b97 C A 19: 12,878,599 (GRCm39) V182F probably benign Het
Or5m9b G A 2: 85,905,104 (GRCm39) V7I possibly damaging Het
Or6d15 T C 6: 116,559,925 (GRCm39) probably benign Het
Pdzd2 G A 15: 12,592,546 (GRCm39) R33W probably damaging Het
Phf21a G A 2: 92,160,860 (GRCm39) V243I probably damaging Het
Ppp1r12b A G 1: 134,821,086 (GRCm39) probably null Het
Rexo5 T C 7: 119,444,634 (GRCm39) V703A probably benign Het
Rgs4 A G 1: 169,572,847 (GRCm39) S30P probably benign Het
Rxra C A 2: 27,646,256 (GRCm39) D340E probably damaging Het
Samhd1 A G 2: 156,949,467 (GRCm39) V473A probably benign Het
Scn3a T A 2: 65,302,686 (GRCm39) K1253N probably damaging Het
Scn7a T C 2: 66,511,299 (GRCm39) N1207S probably benign Het
Sec24d T A 3: 123,130,166 (GRCm39) I443N probably damaging Het
Sema4g T A 19: 44,987,681 (GRCm39) probably null Het
Sema5b A G 16: 35,480,694 (GRCm39) K787R probably benign Het
Serpinc1 A G 1: 160,817,217 (GRCm39) N104D probably benign Het
Sfn T C 4: 133,328,542 (GRCm39) H180R probably damaging Het
Slc22a6 G T 19: 8,596,471 (GRCm39) probably null Het
Slc9a8 T C 2: 167,299,278 (GRCm39) S217P probably benign Het
Smc6 A G 12: 11,359,270 (GRCm39) N965D probably benign Het
Sod2 T A 17: 13,233,919 (GRCm39) I177N probably damaging Het
Sp4 A T 12: 118,263,335 (GRCm39) I237K probably damaging Het
Sulf2 T C 2: 165,921,532 (GRCm39) K697R probably benign Het
Svs4 A T 2: 164,119,005 (GRCm39) D110E unknown Het
Tas1r1 T A 4: 152,122,675 (GRCm39) R57* probably null Het
Tlr5 T C 1: 182,801,287 (GRCm39) I197T probably damaging Het
Tmc3 T C 7: 83,261,740 (GRCm39) V606A probably benign Het
Tmem241 T A 18: 12,251,469 (GRCm39) L37F probably damaging Het
Tmem59l A T 8: 70,938,903 (GRCm39) N90K probably damaging Het
Tram1 A C 1: 13,646,680 (GRCm39) probably benign Het
Trim15 T A 17: 37,176,061 (GRCm39) H162L probably benign Het
Ttc28 T A 5: 111,424,677 (GRCm39) Y1501N probably benign Het
Ttc34 T C 4: 154,946,671 (GRCm39) V857A probably benign Het
Tulp4 A G 17: 6,189,321 (GRCm39) T48A probably damaging Het
Usp9y T C Y: 1,368,089 (GRCm39) E939G probably damaging Het
Utp20 A G 10: 88,606,670 (GRCm39) I1634T probably benign Het
Vmn2r72 T C 7: 85,387,378 (GRCm39) M729V probably benign Het
Vps13c C T 9: 67,788,729 (GRCm39) T334M probably damaging Het
Wnk4 C G 11: 101,167,166 (GRCm39) probably benign Het
Xpo1 A G 11: 23,221,193 (GRCm39) N97D probably benign Het
Xpo4 A T 14: 57,841,129 (GRCm39) F518Y probably benign Het
Zfp668 C T 7: 127,465,778 (GRCm39) V469I possibly damaging Het
Zfp85 C A 13: 67,897,823 (GRCm39) C83F probably damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74,880,558 (GRCm39) splice site probably benign
IGL00542:Birc6 APN 17 74,930,766 (GRCm39) splice site probably null
IGL00659:Birc6 APN 17 74,967,648 (GRCm39) missense probably damaging 1.00
IGL00710:Birc6 APN 17 74,916,084 (GRCm39) missense probably benign 0.37
IGL00806:Birc6 APN 17 74,918,524 (GRCm39) missense possibly damaging 0.85
IGL00848:Birc6 APN 17 75,003,388 (GRCm39) nonsense probably null
IGL01071:Birc6 APN 17 74,873,127 (GRCm39) missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74,938,696 (GRCm39) missense probably damaging 1.00
IGL01121:Birc6 APN 17 74,938,033 (GRCm39) missense probably benign 0.08
IGL01132:Birc6 APN 17 74,910,055 (GRCm39) missense probably damaging 1.00
IGL01323:Birc6 APN 17 74,929,920 (GRCm39) missense probably damaging 1.00
IGL01444:Birc6 APN 17 74,938,682 (GRCm39) missense probably damaging 1.00
IGL01511:Birc6 APN 17 74,933,998 (GRCm39) nonsense probably null
IGL01576:Birc6 APN 17 74,984,365 (GRCm39) missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74,955,192 (GRCm39) missense probably benign 0.08
IGL01649:Birc6 APN 17 74,911,541 (GRCm39) missense probably benign 0.03
IGL01657:Birc6 APN 17 74,967,606 (GRCm39) missense probably damaging 1.00
IGL01739:Birc6 APN 17 74,966,216 (GRCm39) missense probably benign
IGL01756:Birc6 APN 17 74,947,203 (GRCm39) missense probably benign 0.00
IGL01807:Birc6 APN 17 74,938,032 (GRCm39) missense probably benign
IGL01885:Birc6 APN 17 74,911,511 (GRCm39) missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74,945,353 (GRCm39) missense probably damaging 1.00
IGL01915:Birc6 APN 17 74,938,715 (GRCm39) missense probably benign 0.34
IGL01998:Birc6 APN 17 74,886,880 (GRCm39) missense probably benign 0.06
IGL02084:Birc6 APN 17 74,915,277 (GRCm39) missense probably benign 0.45
IGL02086:Birc6 APN 17 74,946,822 (GRCm39) missense probably damaging 1.00
IGL02161:Birc6 APN 17 74,855,832 (GRCm39) missense probably damaging 0.99
IGL02195:Birc6 APN 17 75,004,376 (GRCm39) splice site probably benign
IGL02283:Birc6 APN 17 74,906,935 (GRCm39) missense probably benign
IGL02476:Birc6 APN 17 75,003,386 (GRCm39) missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74,959,054 (GRCm39) unclassified probably benign
IGL02547:Birc6 APN 17 74,886,640 (GRCm39) missense probably benign 0.21
IGL02678:Birc6 APN 17 74,956,898 (GRCm39) missense probably damaging 1.00
IGL02713:Birc6 APN 17 74,886,319 (GRCm39) missense probably benign
IGL02851:Birc6 APN 17 74,916,184 (GRCm39) missense probably damaging 1.00
IGL02875:Birc6 APN 17 74,896,713 (GRCm39) missense probably damaging 1.00
IGL02985:Birc6 APN 17 74,947,185 (GRCm39) missense probably benign 0.00
IGL03004:Birc6 APN 17 74,919,180 (GRCm39) missense probably benign 0.10
IGL03053:Birc6 APN 17 74,872,967 (GRCm39) missense probably damaging 1.00
IGL03085:Birc6 APN 17 74,903,945 (GRCm39) missense probably damaging 0.97
IGL03109:Birc6 APN 17 74,886,329 (GRCm39) missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74,905,994 (GRCm39) missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74,966,226 (GRCm39) missense probably benign
IGL03221:Birc6 APN 17 74,934,002 (GRCm39) missense probably benign 0.00
IGL03230:Birc6 APN 17 74,918,065 (GRCm39) missense probably damaging 1.00
IGL03294:Birc6 APN 17 74,956,881 (GRCm39) missense probably benign 0.02
IGL03399:Birc6 APN 17 74,901,368 (GRCm39) missense probably benign 0.01
Badlands UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
Big_sky UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
bitterroot UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
Black_hills UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
bottomlands UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
Chai UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
Dakota UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
Sempervirens UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
E0370:Birc6 UTSW 17 74,984,352 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
PIT4494001:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R0081:Birc6 UTSW 17 74,950,436 (GRCm39) missense probably benign 0.01
R0086:Birc6 UTSW 17 74,900,161 (GRCm39) missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74,945,371 (GRCm39) missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74,930,741 (GRCm39) splice site probably benign
R0129:Birc6 UTSW 17 74,835,755 (GRCm39) missense probably benign 0.05
R0196:Birc6 UTSW 17 74,887,282 (GRCm39) missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74,916,322 (GRCm39) missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74,969,827 (GRCm39) splice site probably benign
R0295:Birc6 UTSW 17 74,920,357 (GRCm39) intron probably benign
R0386:Birc6 UTSW 17 74,906,335 (GRCm39) missense probably damaging 0.99
R0423:Birc6 UTSW 17 75,003,292 (GRCm39) missense probably damaging 1.00
R0449:Birc6 UTSW 17 74,999,290 (GRCm39) missense probably damaging 1.00
R0453:Birc6 UTSW 17 74,956,749 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,969,620 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,959,023 (GRCm39) missense probably benign
R0564:Birc6 UTSW 17 74,932,238 (GRCm39) splice site probably benign
R0575:Birc6 UTSW 17 74,996,232 (GRCm39) missense probably damaging 1.00
R0582:Birc6 UTSW 17 74,950,332 (GRCm39) missense probably damaging 1.00
R0624:Birc6 UTSW 17 74,887,344 (GRCm39) missense probably benign 0.20
R0973:Birc6 UTSW 17 74,872,856 (GRCm39) missense probably damaging 0.99
R1061:Birc6 UTSW 17 74,996,307 (GRCm39) missense probably damaging 1.00
R1378:Birc6 UTSW 17 74,967,450 (GRCm39) missense probably damaging 1.00
R1402:Birc6 UTSW 17 75,004,528 (GRCm39) splice site probably benign
R1436:Birc6 UTSW 17 74,959,700 (GRCm39) missense probably damaging 1.00
R1456:Birc6 UTSW 17 74,916,285 (GRCm39) missense probably benign 0.35
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1474:Birc6 UTSW 17 74,886,673 (GRCm39) missense probably damaging 0.98
R1479:Birc6 UTSW 17 74,941,848 (GRCm39) missense probably damaging 1.00
R1486:Birc6 UTSW 17 74,946,815 (GRCm39) missense probably damaging 1.00
R1499:Birc6 UTSW 17 74,919,314 (GRCm39) missense probably damaging 1.00
R1515:Birc6 UTSW 17 74,835,631 (GRCm39) nonsense probably null
R1549:Birc6 UTSW 17 74,969,737 (GRCm39) missense probably damaging 1.00
R1559:Birc6 UTSW 17 74,999,232 (GRCm39) missense probably damaging 1.00
R1573:Birc6 UTSW 17 74,967,685 (GRCm39) splice site probably benign
R1615:Birc6 UTSW 17 74,916,404 (GRCm39) splice site probably null
R1621:Birc6 UTSW 17 74,977,245 (GRCm39) missense probably benign
R1680:Birc6 UTSW 17 74,855,741 (GRCm39) missense probably benign 0.01
R1743:Birc6 UTSW 17 74,886,751 (GRCm39) missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74,947,008 (GRCm39) missense probably damaging 1.00
R1818:Birc6 UTSW 17 74,956,844 (GRCm39) missense probably damaging 1.00
R1836:Birc6 UTSW 17 74,921,385 (GRCm39) missense probably benign 0.41
R1931:Birc6 UTSW 17 74,872,977 (GRCm39) missense probably damaging 0.99
R1939:Birc6 UTSW 17 74,977,332 (GRCm39) missense probably damaging 1.00
R1964:Birc6 UTSW 17 74,941,880 (GRCm39) missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74,905,057 (GRCm39) missense probably benign 0.01
R2000:Birc6 UTSW 17 74,911,614 (GRCm39) missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
R2090:Birc6 UTSW 17 74,969,791 (GRCm39) missense probably benign
R2130:Birc6 UTSW 17 74,966,149 (GRCm39) splice site probably benign
R2144:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74,942,790 (GRCm39) missense probably benign 0.02
R2180:Birc6 UTSW 17 74,919,146 (GRCm39) missense probably benign 0.03
R2271:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2272:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2416:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2421:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2422:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2513:Birc6 UTSW 17 74,954,724 (GRCm39) missense probably damaging 0.97
R2912:Birc6 UTSW 17 74,999,201 (GRCm39) missense probably damaging 1.00
R3024:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3772:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3829:Birc6 UTSW 17 74,962,173 (GRCm39) missense probably damaging 1.00
R3913:Birc6 UTSW 17 74,880,608 (GRCm39) nonsense probably null
R3915:Birc6 UTSW 17 74,886,603 (GRCm39) missense probably benign 0.12
R3921:Birc6 UTSW 17 74,934,014 (GRCm39) missense probably damaging 0.98
R3928:Birc6 UTSW 17 74,945,404 (GRCm39) missense probably damaging 1.00
R3928:Birc6 UTSW 17 74,918,170 (GRCm39) missense possibly damaging 0.91
R4111:Birc6 UTSW 17 74,873,010 (GRCm39) missense probably damaging 1.00
R4155:Birc6 UTSW 17 74,903,934 (GRCm39) missense probably benign 0.00
R4163:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R4226:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4227:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4358:Birc6 UTSW 17 74,926,663 (GRCm39) splice site probably null
R4524:Birc6 UTSW 17 74,948,772 (GRCm39) missense probably damaging 1.00
R4605:Birc6 UTSW 17 74,946,929 (GRCm39) missense probably damaging 1.00
R4619:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4620:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4762:Birc6 UTSW 17 74,936,484 (GRCm39) missense probably damaging 1.00
R4814:Birc6 UTSW 17 74,956,667 (GRCm39) missense probably damaging 1.00
R4849:Birc6 UTSW 17 74,954,383 (GRCm39) missense probably damaging 0.99
R4869:Birc6 UTSW 17 74,893,007 (GRCm39) missense probably benign 0.05
R4912:Birc6 UTSW 17 74,872,900 (GRCm39) missense probably damaging 1.00
R4921:Birc6 UTSW 17 74,957,094 (GRCm39) missense probably damaging 1.00
R4942:Birc6 UTSW 17 74,930,045 (GRCm39) missense probably damaging 1.00
R4954:Birc6 UTSW 17 74,919,026 (GRCm39) missense probably damaging 1.00
R4992:Birc6 UTSW 17 74,996,251 (GRCm39) missense probably benign 0.44
R4994:Birc6 UTSW 17 74,901,319 (GRCm39) intron probably benign
R5018:Birc6 UTSW 17 74,947,054 (GRCm39) missense probably damaging 1.00
R5022:Birc6 UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
R5054:Birc6 UTSW 17 74,962,320 (GRCm39) missense probably damaging 1.00
R5068:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5069:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5070:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5196:Birc6 UTSW 17 74,913,136 (GRCm39) splice site probably benign
R5209:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5212:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5216:Birc6 UTSW 17 74,920,465 (GRCm39) missense probably damaging 1.00
R5279:Birc6 UTSW 17 74,957,042 (GRCm39) missense probably damaging 0.98
R5286:Birc6 UTSW 17 74,977,242 (GRCm39) missense probably damaging 1.00
R5399:Birc6 UTSW 17 74,911,573 (GRCm39) missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74,969,685 (GRCm39) missense probably damaging 1.00
R5482:Birc6 UTSW 17 74,948,777 (GRCm39) missense possibly damaging 0.86
R5492:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5504:Birc6 UTSW 17 74,962,208 (GRCm39) missense probably damaging 1.00
R5519:Birc6 UTSW 17 74,887,173 (GRCm39) missense probably benign
R5544:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5608:Birc6 UTSW 17 74,920,539 (GRCm39) missense probably damaging 0.99
R5623:Birc6 UTSW 17 74,835,651 (GRCm39) missense probably damaging 0.99
R5701:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R5707:Birc6 UTSW 17 75,003,399 (GRCm39) missense probably damaging 1.00
R5715:Birc6 UTSW 17 74,938,615 (GRCm39) missense probably damaging 1.00
R5734:Birc6 UTSW 17 74,925,419 (GRCm39) splice site probably benign
R5792:Birc6 UTSW 17 74,938,048 (GRCm39) missense probably benign 0.05
R5809:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5810:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5813:Birc6 UTSW 17 74,953,497 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,232 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,233 (GRCm39) missense probably damaging 0.98
R5960:Birc6 UTSW 17 74,835,760 (GRCm39) missense probably damaging 0.97
R5961:Birc6 UTSW 17 74,953,596 (GRCm39) missense probably damaging 1.00
R5967:Birc6 UTSW 17 74,967,434 (GRCm39) missense probably damaging 0.99
R5970:Birc6 UTSW 17 74,925,497 (GRCm39) missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
R5982:Birc6 UTSW 17 74,955,153 (GRCm39) missense probably benign
R6023:Birc6 UTSW 17 74,961,372 (GRCm39) missense probably benign 0.24
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6243:Birc6 UTSW 17 74,916,382 (GRCm39) missense probably damaging 0.96
R6294:Birc6 UTSW 17 74,996,252 (GRCm39) missense probably benign 0.00
R6327:Birc6 UTSW 17 74,969,774 (GRCm39) missense probably damaging 1.00
R6501:Birc6 UTSW 17 74,886,276 (GRCm39) missense probably damaging 1.00
R6810:Birc6 UTSW 17 74,919,215 (GRCm39) missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
R6822:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
R6835:Birc6 UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
R6945:Birc6 UTSW 17 74,886,526 (GRCm39) missense probably benign 0.04
R6957:Birc6 UTSW 17 74,886,486 (GRCm39) missense probably benign
R6989:Birc6 UTSW 17 74,937,984 (GRCm39) missense probably benign 0.18
R6991:Birc6 UTSW 17 74,869,090 (GRCm39) missense probably damaging 1.00
R7019:Birc6 UTSW 17 74,916,340 (GRCm39) missense probably benign 0.01
R7092:Birc6 UTSW 17 74,953,740 (GRCm39) missense probably damaging 1.00
R7158:Birc6 UTSW 17 74,901,371 (GRCm39) missense probably benign 0.25
R7204:Birc6 UTSW 17 74,947,103 (GRCm39) missense probably damaging 1.00
R7267:Birc6 UTSW 17 74,892,980 (GRCm39) missense probably benign 0.00
R7316:Birc6 UTSW 17 74,911,489 (GRCm39) missense probably damaging 0.99
R7341:Birc6 UTSW 17 74,919,069 (GRCm39) missense probably damaging 1.00
R7404:Birc6 UTSW 17 74,946,789 (GRCm39) missense possibly damaging 0.73
R7449:Birc6 UTSW 17 75,009,336 (GRCm39) missense probably benign
R7498:Birc6 UTSW 17 74,967,465 (GRCm39) missense probably damaging 1.00
R7539:Birc6 UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
R7569:Birc6 UTSW 17 74,905,077 (GRCm39) missense possibly damaging 0.71
R7574:Birc6 UTSW 17 74,886,879 (GRCm39) missense probably benign
R7611:Birc6 UTSW 17 74,969,713 (GRCm39) missense probably damaging 0.98
R7653:Birc6 UTSW 17 74,954,729 (GRCm39) missense possibly damaging 0.91
R7716:Birc6 UTSW 17 74,869,056 (GRCm39) missense probably damaging 0.99
R7728:Birc6 UTSW 17 74,929,100 (GRCm39) missense probably benign 0.01
R7810:Birc6 UTSW 17 74,855,815 (GRCm39) missense probably damaging 0.98
R7828:Birc6 UTSW 17 74,886,501 (GRCm39) missense probably damaging 0.97
R7881:Birc6 UTSW 17 74,948,666 (GRCm39) missense probably damaging 0.99
R7896:Birc6 UTSW 17 74,929,077 (GRCm39) missense probably damaging 0.99
R7950:Birc6 UTSW 17 74,900,095 (GRCm39) missense probably damaging 1.00
R7988:Birc6 UTSW 17 74,906,368 (GRCm39) splice site probably null
R8073:Birc6 UTSW 17 74,910,080 (GRCm39) missense probably damaging 1.00
R8128:Birc6 UTSW 17 74,916,253 (GRCm39) missense probably damaging 1.00
R8167:Birc6 UTSW 17 74,950,389 (GRCm39) missense probably damaging 1.00
R8236:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8237:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8255:Birc6 UTSW 17 74,969,775 (GRCm39) missense probably damaging 0.99
R8259:Birc6 UTSW 17 74,905,073 (GRCm39) missense probably benign 0.01
R8297:Birc6 UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
R8376:Birc6 UTSW 17 74,896,635 (GRCm39) missense probably benign 0.18
R8413:Birc6 UTSW 17 74,853,388 (GRCm39) missense possibly damaging 0.54
R8503:Birc6 UTSW 17 74,999,239 (GRCm39) missense probably damaging 1.00
R8504:Birc6 UTSW 17 74,959,000 (GRCm39) missense probably damaging 0.98
R8543:Birc6 UTSW 17 74,872,860 (GRCm39) missense probably damaging 1.00
R8550:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8551:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8556:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8683:Birc6 UTSW 17 74,916,114 (GRCm39) missense possibly damaging 0.74
R8751:Birc6 UTSW 17 74,955,135 (GRCm39) missense probably damaging 0.98
R8803:Birc6 UTSW 17 74,959,033 (GRCm39) missense probably damaging 0.99
R8806:Birc6 UTSW 17 74,949,311 (GRCm39) missense probably damaging 1.00
R8825:Birc6 UTSW 17 74,920,500 (GRCm39) missense probably damaging 0.99
R8888:Birc6 UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
R8972:Birc6 UTSW 17 75,009,313 (GRCm39) missense probably benign 0.05
R9069:Birc6 UTSW 17 74,868,260 (GRCm39) splice site probably benign
R9111:Birc6 UTSW 17 74,966,340 (GRCm39) missense probably damaging 0.99
R9130:Birc6 UTSW 17 74,919,146 (GRCm39) missense
R9352:Birc6 UTSW 17 74,965,347 (GRCm39) critical splice donor site probably null
R9354:Birc6 UTSW 17 74,921,401 (GRCm39) missense probably benign
R9432:Birc6 UTSW 17 74,966,216 (GRCm39) missense probably benign
R9446:Birc6 UTSW 17 74,925,491 (GRCm39) missense probably damaging 1.00
R9485:Birc6 UTSW 17 74,945,398 (GRCm39) missense probably damaging 1.00
R9499:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9551:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9552:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9585:Birc6 UTSW 17 74,916,265 (GRCm39) missense probably damaging 1.00
R9647:Birc6 UTSW 17 74,999,305 (GRCm39) missense probably damaging 1.00
R9648:Birc6 UTSW 17 74,938,696 (GRCm39) missense probably damaging 1.00
R9667:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R9696:Birc6 UTSW 17 74,947,292 (GRCm39) missense probably damaging 0.99
RF016:Birc6 UTSW 17 74,996,319 (GRCm39) missense probably damaging 1.00
Z1088:Birc6 UTSW 17 74,918,537 (GRCm39) missense probably damaging 0.99
Z1177:Birc6 UTSW 17 74,954,275 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCCTCCGCTCAATAGTGCTAAC -3'
(R):5'- AGCACTTAACTAGCATGCATCAAG -3'

Sequencing Primer
(F):5'- TCCGCTCAATAGTGCTAACAATGC -3'
(R):5'- ACTAGCATGCATCAAGTAACAATTC -3'
Posted On 2014-06-23