Mutagenetix > Incidental Mutation

Incidental Mutation 'R1816:Pik3c2b'

204388

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

039844-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R1816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 133101370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1398 (A1398V)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably benign
Transcript: ENSMUST00000077730
AA Change: A1398V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: A1398V

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Meta Mutation Damage Score

0.0750

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.9%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	T	A	7: 40,994,798	Y721*	probably null	Het
4933405L10Rik	T	A	8: 105,709,859	V220E	possibly damaging	Het
4933434E20Rik	T	C	3: 90,053,091	V13A	possibly damaging	Het
Adam1b	T	G	5: 121,501,725	Q419P	probably damaging	Het
Ankib1	A	G	5: 3,734,028	V316A	probably benign	Het
Anks1	T	A	17: 27,986,573	D294E	probably damaging	Het
Atr	T	C	9: 95,866,694	S431P	probably benign	Het
BC005561	A	G	5: 104,517,834	D74G	probably benign	Het
BC037034	A	G	5: 138,260,341	V548A	possibly damaging	Het
Bfsp1	C	T	2: 143,841,679	A242T	probably benign	Het
Bptf	A	T	11: 107,060,579	V279E	probably damaging	Het
Camkk2	A	G	5: 122,734,180	L540P	probably damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Ceacam12	T	A	7: 18,071,765		probably null	Het
Cntnap5a	G	T	1: 116,428,888	A823S	probably benign	Het
Cp	T	C	3: 19,968,220		probably benign	Het
Dhx58	A	G	11: 100,703,152	V163A	probably damaging	Het
Dicer1	T	C	12: 104,722,151	E389G	probably damaging	Het
Disp1	T	A	1: 183,098,575	D288V	probably damaging	Het
Dnah7a	A	G	1: 53,631,742		probably benign	Het
Eaf2	T	G	16: 36,808,009		probably benign	Het
Efna1	T	C	3: 89,276,387	N44S	possibly damaging	Het
Etnppl	T	C	3: 130,634,562	I462T	probably benign	Het
Fam83d	G	T	2: 158,768,150	A13S	possibly damaging	Het
Fer1l4	C	T	2: 156,035,199	V1139M	probably damaging	Het
Fstl1	A	G	16: 37,826,724		probably null	Het
Gm14226	A	T	2: 155,025,629	D502V	probably damaging	Het
Gm5117	T	A	8: 31,738,958		noncoding transcript	Het
Gm973	A	G	1: 59,582,399	N566S	probably damaging	Het
Grm7	A	T	6: 111,495,791	K16*	probably null	Het
Hbb-bh2	G	A	7: 103,840,378	T17I	possibly damaging	Het
Htt	C	T	5: 34,803,740	A237V	probably benign	Het
Itga6	T	C	2: 71,840,809	V665A	probably benign	Het
Klf4	G	T	4: 55,530,977	R45S	probably benign	Het
Mki67	T	C	7: 135,707,387	D445G	possibly damaging	Het
Myo10	T	C	15: 25,800,200	V1454A	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nudt12	G	A	17: 59,010,136	P172L	probably damaging	Het
Odam	A	G	5: 87,889,470		probably null	Het
Olfr1080	A	T	2: 86,553,667	C152*	probably null	Het
Olfr1179	T	G	2: 88,402,599	I112L	possibly damaging	Het
Olfr393	T	C	11: 73,847,199	K309E	probably benign	Het
Olfr508	T	C	7: 108,630,157	L55P	probably damaging	Het
Olfr695	A	T	7: 106,873,488	Y252*	probably null	Het
Olfr998	G	T	2: 85,590,925	K128N	probably benign	Het
Pcm1	T	A	8: 41,309,537	S1412T	probably damaging	Het
Pgap1	A	G	1: 54,492,057	L753P	probably damaging	Het
Pi4k2b	T	C	5: 52,750,746	S153P	probably damaging	Het
Pkhd1l1	T	C	15: 44,528,239	I1567T	possibly damaging	Het
Rapgef6	G	A	11: 54,694,488	V1571I	probably benign	Het
Rfx2	C	A	17: 56,808,305	E5*	probably null	Het
Sh3tc1	C	A	5: 35,700,584		probably null	Het
Slc22a12	G	A	19: 6,542,653	Q20*	probably null	Het
Slc4a1	A	G	11: 102,351,230	C861R	probably damaging	Het
Snrnp25	G	A	11: 32,207,565	V48I	probably damaging	Het
Spata1	G	T	3: 146,481,207	P211Q	probably damaging	Het
Srgap1	G	A	10: 121,925,971	Q91*	probably null	Het
Stab1	T	C	14: 31,157,465	D686G	probably benign	Het
Stx8	T	A	11: 68,011,326	M112K	possibly damaging	Het
Tfap2b	A	T	1: 19,209,212	K15N	probably damaging	Het
Thbs2	C	A	17: 14,670,713	D1052Y	probably benign	Het
Thbs2	T	A	17: 14,670,714	E1051D	probably benign	Het
Tlr2	T	C	3: 83,838,209	Y189C	probably damaging	Het
Tmem268	C	A	4: 63,565,710	P55T	possibly damaging	Het
Tnpo3	T	C	6: 29,557,017	H745R	probably benign	Het
Ube2s	T	C	7: 4,811,555	N2S	probably damaging	Het
Ulk1	A	G	5: 110,787,831	Y39H	probably damaging	Het
Vmn1r49	G	T	6: 90,072,803	D72E	possibly damaging	Het
Vmn2r27	C	A	6: 124,230,371	G104*	probably null	Het
Vmn2r92	A	G	17: 18,166,677	I93V	probably damaging	Het
Zdhhc20	A	T	14: 57,890,143	V13E	probably benign	Het
Zfp958	A	T	8: 4,629,147	I391F	possibly damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGTGTCCGGTGAGACACAG -3'
(R):5'- GGTTCTTTCTCAAACAGCAGTC -3'

Sequencing Primer
(F):5'- CACAGGTAGGAAGTCTCTGC -3'
(R):5'- AGTCCTGCTAGCTCCCTC -3'

Posted On

2014-06-23