Incidental Mutation 'R0111:Olfr70'
ID20439
Institutional Source Beutler Lab
Gene Symbol Olfr70
Ensembl Gene ENSMUSG00000050215
Gene Nameolfactory receptor 70
SynonymsMOR262-10, GA_x6K02T2N78B-16239704-16240654, mOR6
MMRRC Submission 038397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0111 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location43694784-43700807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43696648 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 175 (N175S)
Ref Sequence ENSEMBL: ENSMUSP00000060748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055545] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000167153]
Predicted Effect probably damaging
Transcript: ENSMUST00000055545
AA Change: N175S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060748
Gene: ENSMUSG00000050215
AA Change: N175S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 9.6e-51 PFAM
Pfam:7tm_1 41 289 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107866
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158322
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A T 17: 55,817,073 H491L possibly damaging Het
Adgrg3 T C 8: 95,035,110 probably benign Het
Arhgap5 T C 12: 52,559,960 probably benign Het
Asic1 T C 15: 99,696,983 Y334H probably damaging Het
Calcr T A 6: 3,717,157 D101V probably damaging Het
Cdh2 A T 18: 16,774,509 N57K probably benign Het
Clec4d C A 6: 123,268,047 Y95* probably null Het
Cracr2a A G 6: 127,604,061 T67A probably benign Het
Dennd5a A T 7: 109,934,754 V53D probably damaging Het
Dnah7a T C 1: 53,468,684 D3076G probably benign Het
Espnl T C 1: 91,344,742 M608T probably benign Het
Fam149a C T 8: 45,341,146 probably benign Het
Fam35a T C 14: 34,267,729 K407E probably damaging Het
Fam46c T C 3: 100,472,786 D218G probably damaging Het
Flnc T C 6: 29,454,340 V1884A probably damaging Het
Helz2 A C 2: 181,237,802 S674R probably benign Het
Hoxa2 T G 6: 52,164,487 probably null Het
Ifi47 T A 11: 49,096,070 N221K probably damaging Het
Ipo9 A G 1: 135,405,924 V340A probably damaging Het
Kalrn A T 16: 34,031,590 N373K probably damaging Het
Kif26a T C 12: 112,163,337 probably benign Het
Kiss1r A G 10: 79,918,689 T6A possibly damaging Het
Lama1 A T 17: 67,737,498 I131F probably damaging Het
Nefm T C 14: 68,124,542 D91G probably benign Het
Nos3 C T 5: 24,372,704 T572I probably damaging Het
Notch2 T C 3: 98,138,761 F1710L probably benign Het
Olfr804 T A 10: 129,705,277 I133N probably damaging Het
Ostm1 T C 10: 42,679,258 L92P probably damaging Het
Pcdh15 T A 10: 74,626,819 Y1445* probably null Het
Pde1b T C 15: 103,503,513 S14P probably benign Het
Pitpna T C 11: 75,625,484 V265A probably benign Het
Plec G T 15: 76,178,646 T2476K probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppp3cc C T 14: 70,256,359 probably null Het
Prss36 A G 7: 127,934,545 L530P probably damaging Het
Ptpn13 T C 5: 103,580,763 probably benign Het
Ptpn23 T C 9: 110,385,623 D1570G probably damaging Het
Rab42 T C 4: 132,302,365 D182G possibly damaging Het
Rbm27 T A 18: 42,305,672 probably benign Het
Rp1 T C 1: 4,344,760 E2043G probably damaging Het
Rufy3 C T 5: 88,630,584 S341F probably damaging Het
Samd9l C T 6: 3,374,946 V772I possibly damaging Het
Scaper A G 9: 55,602,790 M654T probably benign Het
Sipa1l3 G A 7: 29,348,318 P333S probably damaging Het
Slc30a10 C A 1: 185,455,547 R162S probably benign Het
Spryd3 A T 15: 102,128,537 probably null Het
Tas2r110 T C 6: 132,868,203 F66L probably benign Het
Thap2 T C 10: 115,372,627 N196S probably benign Het
Themis2 C A 4: 132,789,925 R88L probably benign Het
Trip12 A T 1: 84,759,133 probably benign Het
Ube3b T A 5: 114,390,376 probably benign Het
Usp20 T A 2: 31,002,612 H64Q probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r15 T C 5: 109,287,156 R561G possibly damaging Het
Vsig10l A G 7: 43,468,101 D604G probably damaging Het
Wdr90 A G 17: 25,848,444 probably benign Het
Xirp2 A T 2: 67,508,378 N321I probably damaging Het
Zfp595 A G 13: 67,320,920 F11S possibly damaging Het
Zfp953 T A 13: 67,343,075 H271L probably damaging Het
Other mutations in Olfr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0501:Olfr70 UTSW 4 43697079 missense probably damaging 1.00
R0973:Olfr70 UTSW 4 43696706 missense probably damaging 1.00
R0973:Olfr70 UTSW 4 43696706 missense probably damaging 1.00
R0974:Olfr70 UTSW 4 43696706 missense probably damaging 1.00
R1413:Olfr70 UTSW 4 43697011 missense possibly damaging 0.87
R1452:Olfr70 UTSW 4 43696823 missense probably benign 0.12
R1574:Olfr70 UTSW 4 43697134 missense possibly damaging 0.85
R1574:Olfr70 UTSW 4 43697134 missense possibly damaging 0.85
R2159:Olfr70 UTSW 4 43697110 missense probably benign 0.01
R3011:Olfr70 UTSW 4 43696624 missense probably damaging 1.00
R5493:Olfr70 UTSW 4 43696225 missense possibly damaging 0.67
R5651:Olfr70 UTSW 4 43696636 missense probably damaging 1.00
R6938:Olfr70 UTSW 4 43696286 missense probably damaging 1.00
R6976:Olfr70 UTSW 4 43697170 start codon destroyed probably null 0.99
R7315:Olfr70 UTSW 4 43696961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACGTGATAATCTTACCCACGC -3'
(R):5'- TTCTGGCTGTGATGGCATACGAC -3'

Sequencing Primer
(F):5'- GTGATGGTTCCATAGAAAATCACCAC -3'
(R):5'- GCATCCAGATGGCAGGAATAA -3'
Posted On2013-04-11