Mutagenetix > Incidental Mutations

Incidental Mutation 'R1816:Tnpo3'

204419

Institutional Source

Beutler Lab

Gene Symbol

Tnpo3

Ensembl Gene

ENSMUSG00000012535

Gene Name

transportin 3

Synonyms

D6Ertd313e, 5730544L10Rik, C430013M08Rik

MMRRC Submission

039844-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29540827-29609887 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29557017 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 745 (H745R)

Ref Sequence

ENSEMBL: ENSMUSP00000110906 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]

Predicted Effect

probably benign
Transcript: ENSMUST00000012679
AA Change: H745R

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: H745R

Domain	Start	End	E-Value	Type
Blast:IBN_N	30	96	6e-35	BLAST
Pfam:Xpo1	101	249	3.5e-30	PFAM
low complexity region	318	328	N/A	INTRINSIC
low complexity region	823	838	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115251
AA Change: H745R

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: H745R

Domain	Start	End	E-Value	Type
Blast:IBN_N	30	96	6e-35	BLAST
Pfam:Xpo1	101	249	3e-30	PFAM
low complexity region	318	328	N/A	INTRINSIC
low complexity region	829	844	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170350

Predicted Effect

unknown
Transcript: ENSMUST00000170647
AA Change: H62R

SMART Domains

Protein: ENSMUSP00000133115
Gene: ENSMUSG00000012535
AA Change: H62R

Domain	Start	End	E-Value	Type
SCOP:d1qbkb_	2	187	1e-5	SMART
PDB:4C0P\|D	2	247	1e-156	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171865

Meta Mutation Damage Score

0.1614

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.9%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	T	A	7: 40,994,798	Y721*	probably null	Het
4933405L10Rik	T	A	8: 105,709,859	V220E	possibly damaging	Het
4933434E20Rik	T	C	3: 90,053,091	V13A	possibly damaging	Het
Adam1b	T	G	5: 121,501,725	Q419P	probably damaging	Het
Ankib1	A	G	5: 3,734,028	V316A	probably benign	Het
Anks1	T	A	17: 27,986,573	D294E	probably damaging	Het
Atr	T	C	9: 95,866,694	S431P	probably benign	Het
BC005561	A	G	5: 104,517,834	D74G	probably benign	Het
BC037034	A	G	5: 138,260,341	V548A	possibly damaging	Het
Bfsp1	C	T	2: 143,841,679	A242T	probably benign	Het
Bptf	A	T	11: 107,060,579	V279E	probably damaging	Het
Camkk2	A	G	5: 122,734,180	L540P	probably damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Ceacam12	T	A	7: 18,071,765		probably null	Het
Cntnap5a	G	T	1: 116,428,888	A823S	probably benign	Het
Cp	T	C	3: 19,968,220		probably benign	Het
Dhx58	A	G	11: 100,703,152	V163A	probably damaging	Het
Dicer1	T	C	12: 104,722,151	E389G	probably damaging	Het
Disp1	T	A	1: 183,098,575	D288V	probably damaging	Het
Dnah7a	A	G	1: 53,631,742		probably benign	Het
Eaf2	T	G	16: 36,808,009		probably benign	Het
Efna1	T	C	3: 89,276,387	N44S	possibly damaging	Het
Etnppl	T	C	3: 130,634,562	I462T	probably benign	Het
Fam83d	G	T	2: 158,768,150	A13S	possibly damaging	Het
Fer1l4	C	T	2: 156,035,199	V1139M	probably damaging	Het
Fstl1	A	G	16: 37,826,724		probably null	Het
Gm14226	A	T	2: 155,025,629	D502V	probably damaging	Het
Gm5117	T	A	8: 31,738,958		noncoding transcript	Het
Gm973	A	G	1: 59,582,399	N566S	probably damaging	Het
Grm7	A	T	6: 111,495,791	K16*	probably null	Het
Hbb-bh2	G	A	7: 103,840,378	T17I	possibly damaging	Het
Htt	C	T	5: 34,803,740	A237V	probably benign	Het
Itga6	T	C	2: 71,840,809	V665A	probably benign	Het
Klf4	G	T	4: 55,530,977	R45S	probably benign	Het
Mki67	T	C	7: 135,707,387	D445G	possibly damaging	Het
Myo10	T	C	15: 25,800,200	V1454A	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nudt12	G	A	17: 59,010,136	P172L	probably damaging	Het
Odam	A	G	5: 87,889,470		probably null	Het
Olfr1080	A	T	2: 86,553,667	C152*	probably null	Het
Olfr1179	T	G	2: 88,402,599	I112L	possibly damaging	Het
Olfr393	T	C	11: 73,847,199	K309E	probably benign	Het
Olfr508	T	C	7: 108,630,157	L55P	probably damaging	Het
Olfr695	A	T	7: 106,873,488	Y252*	probably null	Het
Olfr998	G	T	2: 85,590,925	K128N	probably benign	Het
Pcm1	T	A	8: 41,309,537	S1412T	probably damaging	Het
Pgap1	A	G	1: 54,492,057	L753P	probably damaging	Het
Pi4k2b	T	C	5: 52,750,746	S153P	probably damaging	Het
Pik3c2b	C	T	1: 133,101,370	A1398V	probably benign	Het
Pkhd1l1	T	C	15: 44,528,239	I1567T	possibly damaging	Het
Rapgef6	G	A	11: 54,694,488	V1571I	probably benign	Het
Rfx2	C	A	17: 56,808,305	E5*	probably null	Het
Sh3tc1	C	A	5: 35,700,584		probably null	Het
Slc22a12	G	A	19: 6,542,653	Q20*	probably null	Het
Slc4a1	A	G	11: 102,351,230	C861R	probably damaging	Het
Snrnp25	G	A	11: 32,207,565	V48I	probably damaging	Het
Spata1	G	T	3: 146,481,207	P211Q	probably damaging	Het
Srgap1	G	A	10: 121,925,971	Q91*	probably null	Het
Stab1	T	C	14: 31,157,465	D686G	probably benign	Het
Stx8	T	A	11: 68,011,326	M112K	possibly damaging	Het
Tfap2b	A	T	1: 19,209,212	K15N	probably damaging	Het
Thbs2	C	A	17: 14,670,713	D1052Y	probably benign	Het
Thbs2	T	A	17: 14,670,714	E1051D	probably benign	Het
Tlr2	T	C	3: 83,838,209	Y189C	probably damaging	Het
Tmem268	C	A	4: 63,565,710	P55T	possibly damaging	Het
Ube2s	T	C	7: 4,811,555	N2S	probably damaging	Het
Ulk1	A	G	5: 110,787,831	Y39H	probably damaging	Het
Vmn1r49	G	T	6: 90,072,803	D72E	possibly damaging	Het
Vmn2r27	C	A	6: 124,230,371	G104*	probably null	Het
Vmn2r92	A	G	17: 18,166,677	I93V	probably damaging	Het
Zdhhc20	A	T	14: 57,890,143	V13E	probably benign	Het
Zfp958	A	T	8: 4,629,147	I391F	possibly damaging	Het

Other mutations in Tnpo3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Tnpo3	APN	6	29578461	critical splice donor site	probably null
IGL00662:Tnpo3	APN	6	29565846	nonsense	probably null
IGL00753:Tnpo3	APN	6	29565787	missense	probably benign	0.32
IGL00906:Tnpo3	APN	6	29589048	missense	probably damaging	0.99
IGL01311:Tnpo3	APN	6	29586078	missense	possibly damaging	0.53
IGL01934:Tnpo3	APN	6	29575020	missense	probably benign	0.14
IGL01959:Tnpo3	APN	6	29589020	splice site	probably benign
IGL01987:Tnpo3	APN	6	29560201	missense	probably benign	0.02
IGL02137:Tnpo3	APN	6	29609451	missense	probably damaging	1.00
IGL02645:Tnpo3	APN	6	29562900	nonsense	probably null
IGL03409:Tnpo3	APN	6	29555182	missense	probably damaging	1.00
PIT4520001:Tnpo3	UTSW	6	29555222	missense	possibly damaging	0.60
R0012:Tnpo3	UTSW	6	29589177	missense	probably damaging	0.96
R0012:Tnpo3	UTSW	6	29589177	missense	probably damaging	0.96
R0119:Tnpo3	UTSW	6	29568922	missense	possibly damaging	0.91
R0143:Tnpo3	UTSW	6	29565652	splice site	probably benign
R0384:Tnpo3	UTSW	6	29582164	critical splice donor site	probably null
R0597:Tnpo3	UTSW	6	29578565	nonsense	probably null
R0710:Tnpo3	UTSW	6	29586075	missense	possibly damaging	0.84
R0883:Tnpo3	UTSW	6	29554993	splice site	probably benign
R1494:Tnpo3	UTSW	6	29557044	missense	probably damaging	1.00
R1529:Tnpo3	UTSW	6	29560221	missense	possibly damaging	0.70
R1663:Tnpo3	UTSW	6	29565759	missense	probably benign	0.04
R2077:Tnpo3	UTSW	6	29586144	missense	possibly damaging	0.94
R2113:Tnpo3	UTSW	6	29551872	missense	probably benign	0.07
R2146:Tnpo3	UTSW	6	29589036	missense	probably benign	0.18
R2377:Tnpo3	UTSW	6	29579619	missense	probably benign	0.19
R3765:Tnpo3	UTSW	6	29579689	missense	probably benign	0.00
R3766:Tnpo3	UTSW	6	29579689	missense	probably benign	0.00
R4125:Tnpo3	UTSW	6	29560092	missense	probably damaging	1.00
R4525:Tnpo3	UTSW	6	29561398	missense	probably benign	0.02
R4786:Tnpo3	UTSW	6	29578542	missense	probably benign	0.24
R4830:Tnpo3	UTSW	6	29568938	missense	probably benign	0.00
R4948:Tnpo3	UTSW	6	29582260	missense	probably benign	0.01
R5215:Tnpo3	UTSW	6	29582153	splice site	probably benign
R5325:Tnpo3	UTSW	6	29602013	intron	probably benign
R5512:Tnpo3	UTSW	6	29575046	missense	probably damaging	1.00
R5619:Tnpo3	UTSW	6	29565198	nonsense	probably null
R5689:Tnpo3	UTSW	6	29571064	missense	possibly damaging	0.67
R5855:Tnpo3	UTSW	6	29589033	missense	probably damaging	1.00
R6101:Tnpo3	UTSW	6	29588043	nonsense	probably null
R6105:Tnpo3	UTSW	6	29588043	nonsense	probably null
R6137:Tnpo3	UTSW	6	29555268	missense	probably benign	0.00
R6481:Tnpo3	UTSW	6	29571101	missense	possibly damaging	0.91
R6534:Tnpo3	UTSW	6	29572703	splice site	probably null
R6569:Tnpo3	UTSW	6	29571066	missense	possibly damaging	0.62
R6976:Tnpo3	UTSW	6	29572595	nonsense	probably null
R7006:Tnpo3	UTSW	6	29589163	missense	probably damaging	1.00
R7312:Tnpo3	UTSW	6	29562876	missense	possibly damaging	0.47
R7365:Tnpo3	UTSW	6	29556996	missense	probably damaging	1.00
R7686:Tnpo3	UTSW	6	29562900	nonsense	probably null
R7898:Tnpo3	UTSW	6	29565224	missense	probably benign	0.01
R7901:Tnpo3	UTSW	6	29568991	missense	possibly damaging	0.83
R8003:Tnpo3	UTSW	6	29551901	missense	probably benign	0.09
R8144:Tnpo3	UTSW	6	29558762	missense	probably benign
R8147:Tnpo3	UTSW	6	29589214	missense	probably benign	0.01
R8183:Tnpo3	UTSW	6	29558759	missense	probably damaging	0.97
R8297:Tnpo3	UTSW	6	29582303	missense	possibly damaging	0.91
R8329:Tnpo3	UTSW	6	29558833	nonsense	probably null
R8424:Tnpo3	UTSW	6	29555206	missense	probably benign	0.06
Z1088:Tnpo3	UTSW	6	29565843	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACACATTTCTAGCCCGCC -3'
(R):5'- GGCAAGGGTTCTCTTTTCCTAATC -3'

Sequencing Primer
(F):5'- TGCTGCCAAAGAGATTATGAATC -3'
(R):5'- CTACTCATTACAGTCTTGTCATTGTG -3'

Posted On

2014-06-23