Incidental Mutation 'R0111:Nos3'
ID20442
Institutional Source Beutler Lab
Gene Symbol Nos3
Ensembl Gene ENSMUSG00000028978
Gene Namenitric oxide synthase 3, endothelial cell
SynonymseNOS, 2310065A03Rik, ecNOS, Nos-3
MMRRC Submission 038397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0111 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location24364810-24384474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24372704 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 572 (T572I)
Ref Sequence ENSEMBL: ENSMUSP00000110742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]
Predicted Effect probably damaging
Transcript: ENSMUST00000030834
AA Change: T572I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: T572I

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115090
AA Change: T572I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: T572I

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156403
Meta Mutation Damage Score 0.9556 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A T 17: 55,817,073 H491L possibly damaging Het
Adgrg3 T C 8: 95,035,110 probably benign Het
Arhgap5 T C 12: 52,559,960 probably benign Het
Asic1 T C 15: 99,696,983 Y334H probably damaging Het
Calcr T A 6: 3,717,157 D101V probably damaging Het
Cdh2 A T 18: 16,774,509 N57K probably benign Het
Clec4d C A 6: 123,268,047 Y95* probably null Het
Cracr2a A G 6: 127,604,061 T67A probably benign Het
Dennd5a A T 7: 109,934,754 V53D probably damaging Het
Dnah7a T C 1: 53,468,684 D3076G probably benign Het
Espnl T C 1: 91,344,742 M608T probably benign Het
Fam149a C T 8: 45,341,146 probably benign Het
Fam35a T C 14: 34,267,729 K407E probably damaging Het
Fam46c T C 3: 100,472,786 D218G probably damaging Het
Flnc T C 6: 29,454,340 V1884A probably damaging Het
Helz2 A C 2: 181,237,802 S674R probably benign Het
Hoxa2 T G 6: 52,164,487 probably null Het
Ifi47 T A 11: 49,096,070 N221K probably damaging Het
Ipo9 A G 1: 135,405,924 V340A probably damaging Het
Kalrn A T 16: 34,031,590 N373K probably damaging Het
Kif26a T C 12: 112,163,337 probably benign Het
Kiss1r A G 10: 79,918,689 T6A possibly damaging Het
Lama1 A T 17: 67,737,498 I131F probably damaging Het
Nefm T C 14: 68,124,542 D91G probably benign Het
Notch2 T C 3: 98,138,761 F1710L probably benign Het
Olfr70 T C 4: 43,696,648 N175S probably damaging Het
Olfr804 T A 10: 129,705,277 I133N probably damaging Het
Ostm1 T C 10: 42,679,258 L92P probably damaging Het
Pcdh15 T A 10: 74,626,819 Y1445* probably null Het
Pde1b T C 15: 103,503,513 S14P probably benign Het
Pitpna T C 11: 75,625,484 V265A probably benign Het
Plec G T 15: 76,178,646 T2476K probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppp3cc C T 14: 70,256,359 probably null Het
Prss36 A G 7: 127,934,545 L530P probably damaging Het
Ptpn13 T C 5: 103,580,763 probably benign Het
Ptpn23 T C 9: 110,385,623 D1570G probably damaging Het
Rab42 T C 4: 132,302,365 D182G possibly damaging Het
Rbm27 T A 18: 42,305,672 probably benign Het
Rp1 T C 1: 4,344,760 E2043G probably damaging Het
Rufy3 C T 5: 88,630,584 S341F probably damaging Het
Samd9l C T 6: 3,374,946 V772I possibly damaging Het
Scaper A G 9: 55,602,790 M654T probably benign Het
Sipa1l3 G A 7: 29,348,318 P333S probably damaging Het
Slc30a10 C A 1: 185,455,547 R162S probably benign Het
Spryd3 A T 15: 102,128,537 probably null Het
Tas2r110 T C 6: 132,868,203 F66L probably benign Het
Thap2 T C 10: 115,372,627 N196S probably benign Het
Themis2 C A 4: 132,789,925 R88L probably benign Het
Trip12 A T 1: 84,759,133 probably benign Het
Ube3b T A 5: 114,390,376 probably benign Het
Usp20 T A 2: 31,002,612 H64Q probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r15 T C 5: 109,287,156 R561G possibly damaging Het
Vsig10l A G 7: 43,468,101 D604G probably damaging Het
Wdr90 A G 17: 25,848,444 probably benign Het
Xirp2 A T 2: 67,508,378 N321I probably damaging Het
Zfp595 A G 13: 67,320,920 F11S possibly damaging Het
Zfp953 T A 13: 67,343,075 H271L probably damaging Het
Other mutations in Nos3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Nos3 APN 5 24369862 missense probably damaging 1.00
IGL02059:Nos3 APN 5 24368998 missense probably damaging 1.00
IGL02354:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02361:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02936:Nos3 APN 5 24380993 missense probably damaging 0.97
IGL03190:Nos3 APN 5 24383629 missense probably damaging 1.00
paul UTSW 5 24372704 missense probably damaging 1.00
Peter UTSW 5 24377855 missense probably damaging 0.99
R0387:Nos3 UTSW 5 24367585 missense probably damaging 1.00
R0755:Nos3 UTSW 5 24367297 missense probably damaging 1.00
R1156:Nos3 UTSW 5 24377619 missense probably benign 0.21
R1597:Nos3 UTSW 5 24368997 missense probably damaging 1.00
R1671:Nos3 UTSW 5 24383840 missense probably damaging 1.00
R1743:Nos3 UTSW 5 24377312 missense probably benign 0.22
R1830:Nos3 UTSW 5 24370133 missense probably damaging 1.00
R1882:Nos3 UTSW 5 24368820 missense probably damaging 1.00
R2294:Nos3 UTSW 5 24364857 missense probably damaging 0.99
R3114:Nos3 UTSW 5 24372631 splice site probably benign
R3978:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R3980:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R4016:Nos3 UTSW 5 24371716 missense probably damaging 1.00
R4905:Nos3 UTSW 5 24367331 missense probably benign 0.01
R4947:Nos3 UTSW 5 24377855 missense probably damaging 0.99
R5017:Nos3 UTSW 5 24366719 intron probably benign
R5095:Nos3 UTSW 5 24368918 splice site probably benign
R5096:Nos3 UTSW 5 24371957 missense probably damaging 1.00
R5102:Nos3 UTSW 5 24371627 missense probably damaging 1.00
R5311:Nos3 UTSW 5 24377345 missense probably benign 0.19
R5330:Nos3 UTSW 5 24369904 missense probably damaging 1.00
R5367:Nos3 UTSW 5 24371944 missense probably benign 0.00
R5394:Nos3 UTSW 5 24383890 missense probably benign 0.00
R5574:Nos3 UTSW 5 24368861 missense possibly damaging 0.80
R5889:Nos3 UTSW 5 24368777 intron probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6401:Nos3 UTSW 5 24379811 missense probably benign
R6517:Nos3 UTSW 5 24383624 missense probably damaging 1.00
R6888:Nos3 UTSW 5 24383335 missense possibly damaging 0.86
R6972:Nos3 UTSW 5 24380243 missense probably benign
R6973:Nos3 UTSW 5 24380243 missense probably benign
R7432:Nos3 UTSW 5 24367615 missense probably damaging 0.98
R7434:Nos3 UTSW 5 24382635 missense probably damaging 0.99
R7507:Nos3 UTSW 5 24372644 missense probably damaging 1.00
R7553:Nos3 UTSW 5 24381717 missense possibly damaging 0.62
R7652:Nos3 UTSW 5 24383612 missense probably damaging 1.00
X0020:Nos3 UTSW 5 24370124 missense probably damaging 1.00
X0061:Nos3 UTSW 5 24382635 missense probably damaging 0.99
Z1176:Nos3 UTSW 5 24377654 missense probably benign 0.02
Z1177:Nos3 UTSW 5 24383950 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAGGATTCAGCGTGCAATCAGG -3'
(R):5'- AGAAGTGCCGTCCCCATATCAAAAG -3'

Sequencing Primer
(F):5'- GGCCTTGTCTTGCCTAAGTG -3'
(R):5'- TACAGGAATCAAGGTTCCCAG -3'
Posted On2013-04-11