Incidental Mutation 'R1816:Olfr508'
ID204426
Institutional Source Beutler Lab
Gene Symbol Olfr508
Ensembl Gene ENSMUSG00000063764
Gene Nameolfactory receptor 508
SynonymsMOR204-6, GA_x6K02T2PBJ9-10959726-10960658
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108629994-108631628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108630157 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 55 (L55P)
Ref Sequence ENSEMBL: ENSMUSP00000072686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072914]
Predicted Effect probably damaging
Transcript: ENSMUST00000072914
AA Change: L55P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072686
Gene: ENSMUSG00000063764
AA Change: L55P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-20 PFAM
Meta Mutation Damage Score 0.6104 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Olfr508
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Olfr508 APN 7 108630678 missense probably benign 0.01
IGL02045:Olfr508 APN 7 108630532 missense probably damaging 1.00
IGL03354:Olfr508 APN 7 108630528 missense possibly damaging 0.75
R0047:Olfr508 UTSW 7 108630552 missense probably benign 0.00
R1162:Olfr508 UTSW 7 108630913 missense probably benign 0.00
R1828:Olfr508 UTSW 7 108630648 missense possibly damaging 0.88
R1924:Olfr508 UTSW 7 108630355 missense probably damaging 1.00
R1938:Olfr508 UTSW 7 108630838 missense probably benign 0.42
R2155:Olfr508 UTSW 7 108630777 missense probably damaging 1.00
R3416:Olfr508 UTSW 7 108630018 missense possibly damaging 0.75
R4078:Olfr508 UTSW 7 108630907 missense probably benign 0.31
R4271:Olfr508 UTSW 7 108630353 nonsense probably null
R4884:Olfr508 UTSW 7 108630612 missense probably damaging 0.98
R5842:Olfr508 UTSW 7 108630652 missense probably benign 0.06
R6281:Olfr508 UTSW 7 108630402 missense probably benign 0.24
R6558:Olfr508 UTSW 7 108630188 missense probably damaging 0.99
R6828:Olfr508 UTSW 7 108630293 missense possibly damaging 0.48
R7498:Olfr508 UTSW 7 108630416 nonsense probably null
R7708:Olfr508 UTSW 7 108630841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCTATCATAGATGGAACCTGG -3'
(R):5'- ACATCTGCGTGGCATAGAG -3'

Sequencing Primer
(F):5'- TCATAGATGGAACCTGGAAACTAC -3'
(R):5'- CTACATAGCGATCATAGGCCATGG -3'
Posted On2014-06-23