Incidental Mutation 'R1816:Mki67'
ID204427
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135707387 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 445 (D445G)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033310
AA Change: D445G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: D445G

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211238
AA Change: D71G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211437
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135694671 missense probably benign 0.29
R7336:Mki67 UTSW 7 135713839 missense probably benign 0.03
R7422:Mki67 UTSW 7 135698370 missense probably damaging 1.00
R7451:Mki67 UTSW 7 135699351 missense probably benign 0.01
R7502:Mki67 UTSW 7 135700783 missense possibly damaging 0.53
R7513:Mki67 UTSW 7 135693223 missense probably benign
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGATATGGTTCCCTCCTGCAC -3'
(R):5'- CTGCAAAGGTAGAGGCTCCATC -3'

Sequencing Primer
(F):5'- CATACATCCGATAAAGCTTGCTTC -3'
(R):5'- TAGAGGCTCCATCTGCAGAGAC -3'
Posted On2014-06-23