Incidental Mutation 'R1816:Pcm1'
ID204430
Institutional Source Beutler Lab
Gene Symbol Pcm1
Ensembl Gene ENSMUSG00000031592
Gene Namepericentriolar material 1
Synonyms9430077F19Rik, 2600002H09Rik, C030044G17Rik
MMRRC Submission 039844-MU
Accession Numbers

Genbank: NM_023662; MGI: 1277958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location41239752-41332344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41309537 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1412 (S1412T)
Ref Sequence ENSEMBL: ENSMUSP00000147887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]
Predicted Effect probably damaging
Transcript: ENSMUST00000045218
AA Change: S1373T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592
AA Change: S1373T

DomainStartEndE-ValueType
coiled coil region 218 238 N/A INTRINSIC
coiled coil region 270 301 N/A INTRINSIC
coiled coil region 399 426 N/A INTRINSIC
coiled coil region 492 520 N/A INTRINSIC
low complexity region 527 548 N/A INTRINSIC
low complexity region 622 647 N/A INTRINSIC
coiled coil region 652 683 N/A INTRINSIC
coiled coil region 724 772 N/A INTRINSIC
coiled coil region 822 856 N/A INTRINSIC
coiled coil region 988 1017 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
Pfam:PCM1_C 1369 1999 3.6e-295 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211247
AA Change: S1412T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.2055 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Pcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pcm1 APN 8 41274277 missense probably damaging 1.00
IGL00852:Pcm1 APN 8 41287821 missense probably damaging 1.00
IGL00896:Pcm1 APN 8 41276123 missense possibly damaging 0.70
IGL00927:Pcm1 APN 8 41287881 missense probably damaging 1.00
IGL01085:Pcm1 APN 8 41309603 missense probably damaging 1.00
IGL01684:Pcm1 APN 8 41257923 missense probably benign 0.00
IGL01888:Pcm1 APN 8 41257956 missense probably damaging 0.98
IGL02349:Pcm1 APN 8 41288155 critical splice donor site probably null
IGL02562:Pcm1 APN 8 41325368 missense probably damaging 1.00
IGL02807:Pcm1 APN 8 41330882 missense probably damaging 1.00
IGL03081:Pcm1 APN 8 41275060 missense probably damaging 1.00
shaved UTSW 8 41288156 critical splice donor site probably null
D3080:Pcm1 UTSW 8 41275939 missense probably damaging 1.00
P0045:Pcm1 UTSW 8 41288097 missense probably damaging 0.99
R0090:Pcm1 UTSW 8 41256041 missense probably damaging 0.99
R0109:Pcm1 UTSW 8 41257937 missense possibly damaging 0.88
R0373:Pcm1 UTSW 8 41276111 nonsense probably null
R0386:Pcm1 UTSW 8 41316023 missense probably damaging 1.00
R0452:Pcm1 UTSW 8 41325905 missense probably benign 0.25
R0498:Pcm1 UTSW 8 41293769 missense probably benign 0.01
R0528:Pcm1 UTSW 8 41315930 missense probably damaging 1.00
R0587:Pcm1 UTSW 8 41286051 missense probably damaging 0.99
R0635:Pcm1 UTSW 8 41267179 splice site probably benign
R0725:Pcm1 UTSW 8 41287811 missense probably damaging 1.00
R0762:Pcm1 UTSW 8 41261020 missense probably damaging 1.00
R0848:Pcm1 UTSW 8 41282683 missense probably damaging 1.00
R1027:Pcm1 UTSW 8 41293445 splice site probably benign
R1056:Pcm1 UTSW 8 41321900 missense probably damaging 1.00
R1534:Pcm1 UTSW 8 41287701 missense probably benign
R1566:Pcm1 UTSW 8 41290773 missense probably damaging 1.00
R1595:Pcm1 UTSW 8 41309635 missense probably damaging 1.00
R1719:Pcm1 UTSW 8 41313359 missense possibly damaging 0.62
R2177:Pcm1 UTSW 8 41275965 missense probably benign
R2495:Pcm1 UTSW 8 41293579 missense probably benign
R3737:Pcm1 UTSW 8 41261043 nonsense probably null
R3747:Pcm1 UTSW 8 41332004 missense probably benign 0.44
R3763:Pcm1 UTSW 8 41280077 missense probably damaging 1.00
R3764:Pcm1 UTSW 8 41330882 missense probably damaging 1.00
R3798:Pcm1 UTSW 8 41258014 missense possibly damaging 0.66
R3968:Pcm1 UTSW 8 41325830 missense probably damaging 1.00
R4760:Pcm1 UTSW 8 41287738 missense probably damaging 0.99
R4798:Pcm1 UTSW 8 41293678 missense probably damaging 1.00
R5062:Pcm1 UTSW 8 41259260 missense probably damaging 0.99
R5221:Pcm1 UTSW 8 41288156 critical splice donor site probably null
R5250:Pcm1 UTSW 8 41312205 missense probably damaging 0.99
R5466:Pcm1 UTSW 8 41272462 critical splice donor site probably null
R5470:Pcm1 UTSW 8 41287683 missense probably damaging 1.00
R5958:Pcm1 UTSW 8 41328979 missense probably damaging 1.00
R6043:Pcm1 UTSW 8 41328778 missense possibly damaging 0.54
R6179:Pcm1 UTSW 8 41283632 missense probably damaging 0.99
R6186:Pcm1 UTSW 8 41293793 missense probably benign 0.23
R6227:Pcm1 UTSW 8 41330825 missense probably damaging 0.99
R6368:Pcm1 UTSW 8 41293544 missense probably benign 0.09
R6438:Pcm1 UTSW 8 41325381 missense possibly damaging 0.94
R6459:Pcm1 UTSW 8 41261036 missense probably damaging 1.00
R7399:Pcm1 UTSW 8 41293510 missense probably benign 0.11
R7401:Pcm1 UTSW 8 41309531 missense probably damaging 1.00
R7478:Pcm1 UTSW 8 41261373 missense probably benign 0.17
R7570:Pcm1 UTSW 8 41267344 missense possibly damaging 0.64
R7648:Pcm1 UTSW 8 41275699 missense probably damaging 0.99
R7773:Pcm1 UTSW 8 41309573 nonsense probably null
R7779:Pcm1 UTSW 8 41329024 missense probably damaging 1.00
X0025:Pcm1 UTSW 8 41330642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAAGTACATACAGTTTTCCAGG -3'
(R):5'- TGCTTCACTTAAGGAGCTACCC -3'

Sequencing Primer
(F):5'- ATATAGTCCAAGCTGCTGGC -3'
(R):5'- CCCATATAGAAGCACTGAGTAAGCTG -3'
Posted On2014-06-23