Mutagenetix > Incidental Mutations

Incidental Mutation 'R1816:Dicer1'

204443

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

039844-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104722151 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 389 (E389G)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987] [ENSMUST00000222002]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041987
AA Change: E389G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: E389G

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221293

Predicted Effect

probably damaging
Transcript: ENSMUST00000222002
AA Change: E389G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Meta Mutation Damage Score

0.3368

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.9%

Validation Efficiency

99% (72/73)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	T	A	7: 40,994,798	Y721*	probably null	Het
4933405L10Rik	T	A	8: 105,709,859	V220E	possibly damaging	Het
4933434E20Rik	T	C	3: 90,053,091	V13A	possibly damaging	Het
Adam1b	T	G	5: 121,501,725	Q419P	probably damaging	Het
Ankib1	A	G	5: 3,734,028	V316A	probably benign	Het
Anks1	T	A	17: 27,986,573	D294E	probably damaging	Het
Atr	T	C	9: 95,866,694	S431P	probably benign	Het
BC005561	A	G	5: 104,517,834	D74G	probably benign	Het
BC037034	A	G	5: 138,260,341	V548A	possibly damaging	Het
Bfsp1	C	T	2: 143,841,679	A242T	probably benign	Het
Bptf	A	T	11: 107,060,579	V279E	probably damaging	Het
Camkk2	A	G	5: 122,734,180	L540P	probably damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Ceacam12	T	A	7: 18,071,765		probably null	Het
Cntnap5a	G	T	1: 116,428,888	A823S	probably benign	Het
Cp	T	C	3: 19,968,220		probably benign	Het
Dhx58	A	G	11: 100,703,152	V163A	probably damaging	Het
Disp1	T	A	1: 183,098,575	D288V	probably damaging	Het
Dnah7a	A	G	1: 53,631,742		probably benign	Het
Eaf2	T	G	16: 36,808,009		probably benign	Het
Efna1	T	C	3: 89,276,387	N44S	possibly damaging	Het
Etnppl	T	C	3: 130,634,562	I462T	probably benign	Het
Fam83d	G	T	2: 158,768,150	A13S	possibly damaging	Het
Fer1l4	C	T	2: 156,035,199	V1139M	probably damaging	Het
Fstl1	A	G	16: 37,826,724		probably null	Het
Gm14226	A	T	2: 155,025,629	D502V	probably damaging	Het
Gm5117	T	A	8: 31,738,958		noncoding transcript	Het
Gm973	A	G	1: 59,582,399	N566S	probably damaging	Het
Grm7	A	T	6: 111,495,791	K16*	probably null	Het
Hbb-bh2	G	A	7: 103,840,378	T17I	possibly damaging	Het
Htt	C	T	5: 34,803,740	A237V	probably benign	Het
Itga6	T	C	2: 71,840,809	V665A	probably benign	Het
Klf4	G	T	4: 55,530,977	R45S	probably benign	Het
Mki67	T	C	7: 135,707,387	D445G	possibly damaging	Het
Myo10	T	C	15: 25,800,200	V1454A	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nudt12	G	A	17: 59,010,136	P172L	probably damaging	Het
Odam	A	G	5: 87,889,470		probably null	Het
Olfr1080	A	T	2: 86,553,667	C152*	probably null	Het
Olfr1179	T	G	2: 88,402,599	I112L	possibly damaging	Het
Olfr393	T	C	11: 73,847,199	K309E	probably benign	Het
Olfr508	T	C	7: 108,630,157	L55P	probably damaging	Het
Olfr695	A	T	7: 106,873,488	Y252*	probably null	Het
Olfr998	G	T	2: 85,590,925	K128N	probably benign	Het
Pcm1	T	A	8: 41,309,537	S1412T	probably damaging	Het
Pgap1	A	G	1: 54,492,057	L753P	probably damaging	Het
Pi4k2b	T	C	5: 52,750,746	S153P	probably damaging	Het
Pik3c2b	C	T	1: 133,101,370	A1398V	probably benign	Het
Pkhd1l1	T	C	15: 44,528,239	I1567T	possibly damaging	Het
Rapgef6	G	A	11: 54,694,488	V1571I	probably benign	Het
Rfx2	C	A	17: 56,808,305	E5*	probably null	Het
Sh3tc1	C	A	5: 35,700,584		probably null	Het
Slc22a12	G	A	19: 6,542,653	Q20*	probably null	Het
Slc4a1	A	G	11: 102,351,230	C861R	probably damaging	Het
Snrnp25	G	A	11: 32,207,565	V48I	probably damaging	Het
Spata1	G	T	3: 146,481,207	P211Q	probably damaging	Het
Srgap1	G	A	10: 121,925,971	Q91*	probably null	Het
Stab1	T	C	14: 31,157,465	D686G	probably benign	Het
Stx8	T	A	11: 68,011,326	M112K	possibly damaging	Het
Tfap2b	A	T	1: 19,209,212	K15N	probably damaging	Het
Thbs2	C	A	17: 14,670,713	D1052Y	probably benign	Het
Thbs2	T	A	17: 14,670,714	E1051D	probably benign	Het
Tlr2	T	C	3: 83,838,209	Y189C	probably damaging	Het
Tmem268	C	A	4: 63,565,710	P55T	possibly damaging	Het
Tnpo3	T	C	6: 29,557,017	H745R	probably benign	Het
Ube2s	T	C	7: 4,811,555	N2S	probably damaging	Het
Ulk1	A	G	5: 110,787,831	Y39H	probably damaging	Het
Vmn1r49	G	T	6: 90,072,803	D72E	possibly damaging	Het
Vmn2r27	C	A	6: 124,230,371	G104*	probably null	Het
Vmn2r92	A	G	17: 18,166,677	I93V	probably damaging	Het
Zdhhc20	A	T	14: 57,890,143	V13E	probably benign	Het
Zfp958	A	T	8: 4,629,147	I391F	possibly damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2203:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GATGAGAAAGCCCTTCTGAGG -3'
(R):5'- AGGAGCTACACAGGAAGTTCC -3'

Sequencing Primer
(F):5'- AGCACTGCTTCCCCACAGG -3'
(R):5'- GGAAGTTCCTATTGTTTACAGACACC -3'

Posted On

2014-06-23