Mutagenetix > Incidental Mutations

Incidental Mutation 'R1816:Stab1'

204444

Institutional Source

Beutler Lab

Gene Symbol

Stab1

Ensembl Gene

ENSMUSG00000042286

Gene Name

stabilin 1

Synonyms

MS-1

MMRRC Submission

039844-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31139013-31168641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31157465 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 686 (D686G)

Ref Sequence

ENSEMBL: ENSMUSP00000046199 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036618]

Predicted Effect

probably benign
Transcript: ENSMUST00000036618
AA Change: D686G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: D686G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	112	149	6.65e-2	SMART
EGF	160	194	2.28e0	SMART
EGF	199	232	1.4e0	SMART
EGF	236	272	4.97e-1	SMART
EGF	276	319	1.95e1	SMART
EGF_like	321	357	5.03e1	SMART
low complexity region	400	413	N/A	INTRINSIC
Blast:FAS1	414	501	2e-52	BLAST
FAS1	543	645	1.35e-24	SMART
EGF_like	780	817	5.45e1	SMART
EGF	822	861	1.08e-1	SMART
EGF	865	904	3.15e-3	SMART
EGF	908	947	1.3e1	SMART
EGF	951	989	1.47e1	SMART
FAS1	1023	1122	1.3e-17	SMART
FAS1	1165	1257	2.94e0	SMART
EGF	1332	1369	1.4e0	SMART
EGF	1379	1413	1.88e-1	SMART
EGF	1420	1455	6.02e0	SMART
EGF	1459	1497	3.82e-2	SMART
EGF	1501	1540	2.05e-2	SMART
EGF	1544	1583	2.25e1	SMART
FAS1	1616	1712	1.61e-22	SMART
FAS1	1763	1868	2.12e-17	SMART
EGF	1970	2007	1.26e-2	SMART
EGF	2017	2051	1.61e0	SMART
EGF	2059	2090	2.45e0	SMART
EGF	2094	2131	3.46e0	SMART
EGF	2135	2174	3.82e-2	SMART
LINK	2206	2301	8.55e-49	SMART
FAS1	2367	2462	2.06e-6	SMART
transmembrane domain	2476	2498	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159532

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159757

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161464

Meta Mutation Damage Score

0.1413

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.9%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	T	A	7: 40,994,798	Y721*	probably null	Het
4933405L10Rik	T	A	8: 105,709,859	V220E	possibly damaging	Het
4933434E20Rik	T	C	3: 90,053,091	V13A	possibly damaging	Het
Adam1b	T	G	5: 121,501,725	Q419P	probably damaging	Het
Ankib1	A	G	5: 3,734,028	V316A	probably benign	Het
Anks1	T	A	17: 27,986,573	D294E	probably damaging	Het
Atr	T	C	9: 95,866,694	S431P	probably benign	Het
BC005561	A	G	5: 104,517,834	D74G	probably benign	Het
BC037034	A	G	5: 138,260,341	V548A	possibly damaging	Het
Bfsp1	C	T	2: 143,841,679	A242T	probably benign	Het
Bptf	A	T	11: 107,060,579	V279E	probably damaging	Het
Camkk2	A	G	5: 122,734,180	L540P	probably damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Ceacam12	T	A	7: 18,071,765		probably null	Het
Cntnap5a	G	T	1: 116,428,888	A823S	probably benign	Het
Cp	T	C	3: 19,968,220		probably benign	Het
Dhx58	A	G	11: 100,703,152	V163A	probably damaging	Het
Dicer1	T	C	12: 104,722,151	E389G	probably damaging	Het
Disp1	T	A	1: 183,098,575	D288V	probably damaging	Het
Dnah7a	A	G	1: 53,631,742		probably benign	Het
Eaf2	T	G	16: 36,808,009		probably benign	Het
Efna1	T	C	3: 89,276,387	N44S	possibly damaging	Het
Etnppl	T	C	3: 130,634,562	I462T	probably benign	Het
Fam83d	G	T	2: 158,768,150	A13S	possibly damaging	Het
Fer1l4	C	T	2: 156,035,199	V1139M	probably damaging	Het
Fstl1	A	G	16: 37,826,724		probably null	Het
Gm14226	A	T	2: 155,025,629	D502V	probably damaging	Het
Gm5117	T	A	8: 31,738,958		noncoding transcript	Het
Gm973	A	G	1: 59,582,399	N566S	probably damaging	Het
Grm7	A	T	6: 111,495,791	K16*	probably null	Het
Hbb-bh2	G	A	7: 103,840,378	T17I	possibly damaging	Het
Htt	C	T	5: 34,803,740	A237V	probably benign	Het
Itga6	T	C	2: 71,840,809	V665A	probably benign	Het
Klf4	G	T	4: 55,530,977	R45S	probably benign	Het
Mki67	T	C	7: 135,707,387	D445G	possibly damaging	Het
Myo10	T	C	15: 25,800,200	V1454A	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nudt12	G	A	17: 59,010,136	P172L	probably damaging	Het
Odam	A	G	5: 87,889,470		probably null	Het
Olfr1080	A	T	2: 86,553,667	C152*	probably null	Het
Olfr1179	T	G	2: 88,402,599	I112L	possibly damaging	Het
Olfr393	T	C	11: 73,847,199	K309E	probably benign	Het
Olfr508	T	C	7: 108,630,157	L55P	probably damaging	Het
Olfr695	A	T	7: 106,873,488	Y252*	probably null	Het
Olfr998	G	T	2: 85,590,925	K128N	probably benign	Het
Pcm1	T	A	8: 41,309,537	S1412T	probably damaging	Het
Pgap1	A	G	1: 54,492,057	L753P	probably damaging	Het
Pi4k2b	T	C	5: 52,750,746	S153P	probably damaging	Het
Pik3c2b	C	T	1: 133,101,370	A1398V	probably benign	Het
Pkhd1l1	T	C	15: 44,528,239	I1567T	possibly damaging	Het
Rapgef6	G	A	11: 54,694,488	V1571I	probably benign	Het
Rfx2	C	A	17: 56,808,305	E5*	probably null	Het
Sh3tc1	C	A	5: 35,700,584		probably null	Het
Slc22a12	G	A	19: 6,542,653	Q20*	probably null	Het
Slc4a1	A	G	11: 102,351,230	C861R	probably damaging	Het
Snrnp25	G	A	11: 32,207,565	V48I	probably damaging	Het
Spata1	G	T	3: 146,481,207	P211Q	probably damaging	Het
Srgap1	G	A	10: 121,925,971	Q91*	probably null	Het
Stx8	T	A	11: 68,011,326	M112K	possibly damaging	Het
Tfap2b	A	T	1: 19,209,212	K15N	probably damaging	Het
Thbs2	C	A	17: 14,670,713	D1052Y	probably benign	Het
Thbs2	T	A	17: 14,670,714	E1051D	probably benign	Het
Tlr2	T	C	3: 83,838,209	Y189C	probably damaging	Het
Tmem268	C	A	4: 63,565,710	P55T	possibly damaging	Het
Tnpo3	T	C	6: 29,557,017	H745R	probably benign	Het
Ube2s	T	C	7: 4,811,555	N2S	probably damaging	Het
Ulk1	A	G	5: 110,787,831	Y39H	probably damaging	Het
Vmn1r49	G	T	6: 90,072,803	D72E	possibly damaging	Het
Vmn2r27	C	A	6: 124,230,371	G104*	probably null	Het
Vmn2r92	A	G	17: 18,166,677	I93V	probably damaging	Het
Zdhhc20	A	T	14: 57,890,143	V13E	probably benign	Het
Zfp958	A	T	8: 4,629,147	I391F	possibly damaging	Het

Other mutations in Stab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Stab1	APN	14	31161357	missense	probably benign	0.01
IGL00323:Stab1	APN	14	31139306	missense	probably benign	0.04
IGL00515:Stab1	APN	14	31159729	missense	probably benign	0.20
IGL00844:Stab1	APN	14	31147066	missense	probably damaging	1.00
IGL01374:Stab1	APN	14	31147075	missense	probably damaging	1.00
IGL01384:Stab1	APN	14	31150408	missense	probably benign
IGL01431:Stab1	APN	14	31148995	missense	probably benign	0.06
IGL01787:Stab1	APN	14	31139808	missense	probably damaging	1.00
IGL02128:Stab1	APN	14	31150441	missense	probably damaging	1.00
IGL02138:Stab1	APN	14	31143513	critical splice donor site	probably null
IGL02256:Stab1	APN	14	31141592	missense	probably damaging	1.00
IGL02340:Stab1	APN	14	31140410	missense	probably damaging	0.96
IGL02507:Stab1	APN	14	31139210	unclassified	probably benign
IGL02695:Stab1	APN	14	31159271	missense	probably damaging	1.00
IGL02755:Stab1	APN	14	31139638	missense	probably benign	0.01
IGL02870:Stab1	APN	14	31139397	missense	probably benign	0.00
IGL02884:Stab1	APN	14	31150143	splice site	probably null
IGL03035:Stab1	APN	14	31147769	missense	probably benign	0.00
IGL03267:Stab1	APN	14	31142729	missense	probably damaging	1.00
IGL03286:Stab1	APN	14	31159326	splice site	probably benign
IGL03366:Stab1	APN	14	31150263	missense	possibly damaging	0.58
IGL03412:Stab1	APN	14	31154407	missense	probably benign	0.42
IGL02835:Stab1	UTSW	14	31146024	critical splice donor site	probably null
K7371:Stab1	UTSW	14	31150249	missense	probably damaging	1.00
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0363:Stab1	UTSW	14	31159008	splice site	probably benign
R0387:Stab1	UTSW	14	31148101	missense	probably benign	0.00
R0391:Stab1	UTSW	14	31143418	missense	probably benign	0.21
R0513:Stab1	UTSW	14	31148945	missense	probably benign	0.08
R0546:Stab1	UTSW	14	31139550	missense	possibly damaging	0.92
R0825:Stab1	UTSW	14	31152600	missense	probably benign	0.16
R0906:Stab1	UTSW	14	31145249	missense	probably benign	0.19
R0963:Stab1	UTSW	14	31147274	missense	probably damaging	0.97
R1219:Stab1	UTSW	14	31140621	unclassified	probably null
R1234:Stab1	UTSW	14	31150236	missense	probably damaging	1.00
R1260:Stab1	UTSW	14	31151889	missense	probably damaging	1.00
R1400:Stab1	UTSW	14	31139830	missense	possibly damaging	0.92
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1440:Stab1	UTSW	14	31151690	nonsense	probably null
R1472:Stab1	UTSW	14	31141586	missense	probably benign	0.01
R1474:Stab1	UTSW	14	31149861	missense	probably benign	0.45
R1475:Stab1	UTSW	14	31163828	missense	probably benign
R1509:Stab1	UTSW	14	31151584	splice site	probably benign
R1551:Stab1	UTSW	14	31160499	missense	probably benign	0.00
R1572:Stab1	UTSW	14	31150823	missense	probably damaging	1.00
R1633:Stab1	UTSW	14	31150380	intron	probably null
R1719:Stab1	UTSW	14	31146028	nonsense	probably null
R1733:Stab1	UTSW	14	31145303	missense	probably damaging	1.00
R1763:Stab1	UTSW	14	31168416	missense	probably benign	0.04
R1808:Stab1	UTSW	14	31141144	missense	possibly damaging	0.80
R1853:Stab1	UTSW	14	31140463	missense	probably damaging	1.00
R1891:Stab1	UTSW	14	31141330	missense	probably benign	0.07
R1984:Stab1	UTSW	14	31150648	missense	probably benign	0.20
R1998:Stab1	UTSW	14	31162153	nonsense	probably null
R2165:Stab1	UTSW	14	31168435	missense	probably benign	0.20
R2191:Stab1	UTSW	14	31142800	missense	probably benign	0.03
R2191:Stab1	UTSW	14	31159270	missense	probably damaging	1.00
R2233:Stab1	UTSW	14	31161880	missense	probably benign	0.08
R2303:Stab1	UTSW	14	31146070	missense	probably damaging	1.00
R2496:Stab1	UTSW	14	31161463	missense	probably damaging	1.00
R2504:Stab1	UTSW	14	31163040	critical splice donor site	probably null
R2519:Stab1	UTSW	14	31154872	missense	probably damaging	1.00
R2926:Stab1	UTSW	14	31161799	missense	probably damaging	1.00
R4025:Stab1	UTSW	14	31154952	missense	possibly damaging	0.46
R4113:Stab1	UTSW	14	31168479	missense	probably damaging	0.98
R4258:Stab1	UTSW	14	31154672	missense	possibly damaging	0.92
R4588:Stab1	UTSW	14	31157445	missense	probably benign	0.01
R4644:Stab1	UTSW	14	31140487	unclassified	probably benign
R4660:Stab1	UTSW	14	31154915	missense	possibly damaging	0.91
R4801:Stab1	UTSW	14	31141371	nonsense	probably null
R4802:Stab1	UTSW	14	31141371	nonsense	probably null
R4870:Stab1	UTSW	14	31142043	missense	probably benign	0.13
R4872:Stab1	UTSW	14	31140393	missense	probably damaging	1.00
R4881:Stab1	UTSW	14	31143672	missense	probably benign	0.32
R4941:Stab1	UTSW	14	31151571	missense	probably benign	0.00
R5061:Stab1	UTSW	14	31163099	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31143624	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5087:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5092:Stab1	UTSW	14	31145855	missense	probably benign	0.01
R5102:Stab1	UTSW	14	31148017	critical splice donor site	probably null
R5107:Stab1	UTSW	14	31163795	splice site	probably null
R5195:Stab1	UTSW	14	31140521	unclassified	probably benign
R5217:Stab1	UTSW	14	31159519	missense	probably benign	0.25
R5285:Stab1	UTSW	14	31143476	unclassified	probably benign
R5327:Stab1	UTSW	14	31161836	nonsense	probably null
R5647:Stab1	UTSW	14	31157440	nonsense	probably null
R5696:Stab1	UTSW	14	31160221	missense	probably benign
R5996:Stab1	UTSW	14	31139551	missense	probably benign	0.39
R6016:Stab1	UTSW	14	31158993	missense	probably damaging	1.00
R6017:Stab1	UTSW	14	31141544	missense	probably benign	0.00
R6174:Stab1	UTSW	14	31162519	nonsense	probably null
R6366:Stab1	UTSW	14	31141438	missense	probably benign	0.10
R6754:Stab1	UTSW	14	31141081	missense	probably benign
R6788:Stab1	UTSW	14	31139160	missense	probably damaging	1.00
R6898:Stab1	UTSW	14	31158963	missense	probably benign	0.00
R7124:Stab1	UTSW	14	31160867	missense	possibly damaging	0.94
R7145:Stab1	UTSW	14	31145073	critical splice donor site	probably null
R7153:Stab1	UTSW	14	31160584	missense	probably benign	0.16
R7213:Stab1	UTSW	14	31143673	missense	probably benign
R7215:Stab1	UTSW	14	31160797	missense	possibly damaging	0.93
R7319:Stab1	UTSW	14	31140826	missense	probably damaging	1.00
R7389:Stab1	UTSW	14	31147239	missense	probably benign	0.00
R7400:Stab1	UTSW	14	31157384	missense	probably null	1.00
R7427:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7428:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7484:Stab1	UTSW	14	31160317	missense	probably benign	0.00
R7568:Stab1	UTSW	14	31152595	missense	probably damaging	1.00
R7574:Stab1	UTSW	14	31154665	missense	probably benign
R7619:Stab1	UTSW	14	31145237	missense	probably benign
R7623:Stab1	UTSW	14	31140621	missense	probably benign	0.03
R7721:Stab1	UTSW	14	31141456	missense	possibly damaging	0.48
X0026:Stab1	UTSW	14	31162191	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ATGGAAGGCCTTGGTTCTAATC -3'
(R):5'- TCAAGCATACCCAGGTTGCG -3'

Sequencing Primer
(F):5'- AAGGCCTTGGTTCTAATCTTAGC -3'
(R):5'- ATACCCAGGTTGCGGTGGG -3'

Posted On

2014-06-23