Incidental Mutation 'R1816:Slc22a12'
ID204457
Institutional Source Beutler Lab
Gene Symbol Slc22a12
Ensembl Gene ENSMUSG00000061742
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 12
SynonymsRst, URAT1
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6535845-6543019 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 6542653 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 20 (Q20*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113451] [ENSMUST00000113459]
Predicted Effect probably null
Transcript: ENSMUST00000113451
AA Change: Q34*
SMART Domains Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742
AA Change: Q34*

DomainStartEndE-ValueType
Pfam:Sugar_tr 95 525 2e-26 PFAM
Pfam:MFS_1 128 484 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113459
SMART Domains Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 238 1.26e-19 SMART
low complexity region 267 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126142
AA Change: Q20*
SMART Domains Protein: ENSMUSP00000114626
Gene: ENSMUSG00000061742
AA Change: Q20*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 229 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153483
Meta Mutation Damage Score 0.9656 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary urate levels and altered urine and plasma metabolite composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Slc22a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Slc22a12 APN 19 6537814 missense probably benign 0.19
IGL02586:Slc22a12 APN 19 6540457 missense probably benign 0.03
R1353:Slc22a12 UTSW 19 6537782 missense possibly damaging 0.66
R1757:Slc22a12 UTSW 19 6536731 splice site probably null
R2254:Slc22a12 UTSW 19 6542541 missense possibly damaging 0.86
R4110:Slc22a12 UTSW 19 6540628 missense probably damaging 1.00
R4125:Slc22a12 UTSW 19 6538788 missense probably damaging 0.99
R4342:Slc22a12 UTSW 19 6541099 missense probably benign 0.15
R4762:Slc22a12 UTSW 19 6538444 missense probably benign 0.02
R4927:Slc22a12 UTSW 19 6537761 missense probably benign 0.23
R5690:Slc22a12 UTSW 19 6536848 missense probably benign 0.00
R5772:Slc22a12 UTSW 19 6540449 missense possibly damaging 0.67
R5946:Slc22a12 UTSW 19 6537851 missense probably damaging 1.00
R6137:Slc22a12 UTSW 19 6542724 missense probably benign 0.07
X0062:Slc22a12 UTSW 19 6537127 missense probably damaging 1.00
Z1088:Slc22a12 UTSW 19 6538463 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CCATTGAGGTTGTCGGAAGC -3'
(R):5'- ATATGAAGAGACTGGTGTGGTC -3'

Sequencing Primer
(F):5'- TTGTCGGAAGCGGAGGCAC -3'
(R):5'- CTGGTGTGGTCAGAGCCAAG -3'
Posted On2014-06-23