Incidental Mutation 'R1817:Ddx20'
ID204474
Institutional Source Beutler Lab
Gene Symbol Ddx20
Ensembl Gene ENSMUSG00000027905
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 20
SynonymsGEMIN3, dp103
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105678270-105687574 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105678580 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 816 (Y816*)
Ref Sequence ENSEMBL: ENSMUSP00000088176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090680] [ENSMUST00000098761] [ENSMUST00000200078]
Predicted Effect probably null
Transcript: ENSMUST00000090680
AA Change: Y816*
SMART Domains Protein: ENSMUSP00000088176
Gene: ENSMUSG00000027905
AA Change: Y816*

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
DEXDc 82 280 7.47e-44 SMART
HELICc 324 405 2.8e-25 SMART
low complexity region 434 445 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098761
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132008
Predicted Effect probably benign
Transcript: ENSMUST00000200078
SMART Domains Protein: ENSMUSP00000142675
Gene: ENSMUSG00000027905

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
Pfam:DEAD 87 134 7.6e-5 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. This protein interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to implant and develop past the 2-cell stage. Heterozygous null females are viable, healthy and fertile but show increased ovary weight, a greater number of empty follicles, a prolonged estrous phase, and reduced nocturnal and stress-induced serum ACTH levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Ddx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ddx20 APN 3 105686670 missense probably damaging 1.00
IGL01832:Ddx20 APN 3 105679011 missense probably damaging 0.99
IGL02072:Ddx20 APN 3 105680627 missense probably damaging 1.00
IGL02821:Ddx20 APN 3 105679277 missense probably benign 0.00
R0520:Ddx20 UTSW 3 105687376 missense probably benign
R0600:Ddx20 UTSW 3 105679080 missense probably damaging 1.00
R1648:Ddx20 UTSW 3 105679188 missense probably benign 0.08
R1843:Ddx20 UTSW 3 105679082 missense probably benign 0.00
R1922:Ddx20 UTSW 3 105678584 missense probably damaging 1.00
R1955:Ddx20 UTSW 3 105679562 missense possibly damaging 0.79
R1993:Ddx20 UTSW 3 105679344 nonsense probably null
R2215:Ddx20 UTSW 3 105680340 splice site probably benign
R2241:Ddx20 UTSW 3 105683205 nonsense probably null
R2315:Ddx20 UTSW 3 105678699 missense probably damaging 1.00
R4156:Ddx20 UTSW 3 105678933 missense probably benign 0.41
R4790:Ddx20 UTSW 3 105683169 missense probably benign 0.02
R4962:Ddx20 UTSW 3 105680605 missense possibly damaging 0.95
R5072:Ddx20 UTSW 3 105682875 critical splice donor site probably null
R5361:Ddx20 UTSW 3 105683509 missense probably damaging 0.96
R5622:Ddx20 UTSW 3 105679011 missense probably damaging 0.99
R5936:Ddx20 UTSW 3 105680587 missense possibly damaging 0.96
R6007:Ddx20 UTSW 3 105683420 missense possibly damaging 0.68
R6192:Ddx20 UTSW 3 105678720 missense probably benign
R6916:Ddx20 UTSW 3 105680613 missense probably damaging 1.00
R6957:Ddx20 UTSW 3 105684310 missense probably benign 0.30
R6970:Ddx20 UTSW 3 105680358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACATGAAGTGGCACCTTGG -3'
(R):5'- ATGACTGTCACAGGGAAACAAC -3'

Sequencing Primer
(F):5'- AGCCTCAAGTCCTCTCAA -3'
(R):5'- CAGGGAAACAACTGCAAGTTTTTCTG -3'
Posted On2014-06-23