Incidental Mutation 'R1817:Babam2'
ID204480
Institutional Source Beutler Lab
Gene Symbol Babam2
Ensembl Gene ENSMUSG00000052139
Gene NameBRISC and BRCA1 A complex member 2
SynonymsBre, 6030405P19Rik, B830038C02Rik
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31697684-32084962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32057546 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000144205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063813] [ENSMUST00000071531] [ENSMUST00000114507] [ENSMUST00000114515] [ENSMUST00000131995] [ENSMUST00000200705] [ENSMUST00000201352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063813
AA Change: T361A

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069133
Gene: ENSMUSG00000052139
AA Change: T361A

DomainStartEndE-ValueType
Pfam:BRE 70 370 3.4e-133 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071531
AA Change: T315A

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071462
Gene: ENSMUSG00000052139
AA Change: T315A

DomainStartEndE-ValueType
Pfam:BRE 28 324 2.2e-204 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114507
AA Change: T260A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110152
Gene: ENSMUSG00000052139
AA Change: T260A

DomainStartEndE-ValueType
Pfam:BRE 3 269 9.5e-182 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114515
AA Change: T324A

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110160
Gene: ENSMUSG00000052139
AA Change: T324A

DomainStartEndE-ValueType
Pfam:BRE 1 333 4.9e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131995
AA Change: T186A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128351
Gene: ENSMUSG00000052139
AA Change: T186A

DomainStartEndE-ValueType
Pfam:BRE 1 195 4.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200705
SMART Domains Protein: ENSMUSP00000143964
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 8 204 1.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201352
AA Change: T324A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144205
Gene: ENSMUSG00000052139
AA Change: T324A

DomainStartEndE-ValueType
Pfam:BRE 8 333 8.1e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202080
Meta Mutation Damage Score 0.2211 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an anti-apoptotic, death receptor-associated protein that interacts with tumor necrosis factor-receptor-1. The encoded protein acts as an adapter in several protein complexes, including the BRCA1-A complex and the BRISC complex. The BRCA1-A complex possesses ubiquitinase activity and targets sites of double strand DNA breaks, while the BRISC complex exhibits deubiquitinase activity and is involved in mitotic spindle assembly. This gene is upregulated in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. However, fibroblasts exhibit decreased proliferation and increased cellular replicative senescence in response to irradiation and hydrogen peroxide with impaired DNA damage repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Babam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Babam2 APN 5 32007307 missense probably damaging 1.00
IGL01815:Babam2 APN 5 31702098 missense possibly damaging 0.90
IGL02869:Babam2 APN 5 32004772 missense possibly damaging 0.92
IGL03091:Babam2 APN 5 31785678 splice site probably null
IGL03185:Babam2 APN 5 31702032 missense possibly damaging 0.60
R4012:Babam2 UTSW 5 32001438 missense probably damaging 1.00
R4257:Babam2 UTSW 5 31702070 missense possibly damaging 0.76
R4522:Babam2 UTSW 5 32007242 missense probably damaging 1.00
R4622:Babam2 UTSW 5 32007312 missense probably damaging 0.99
R4738:Babam2 UTSW 5 31901142 missense probably damaging 0.99
R4752:Babam2 UTSW 5 31702047 intron probably benign
R4927:Babam2 UTSW 5 31702064 missense probably benign 0.00
R4962:Babam2 UTSW 5 31785583 missense possibly damaging 0.75
R5374:Babam2 UTSW 5 32007230 splice site probably benign
R5375:Babam2 UTSW 5 31701863 missense possibly damaging 0.52
R5453:Babam2 UTSW 5 32007246 missense probably damaging 1.00
R5890:Babam2 UTSW 5 32064807 intron probably benign
R5915:Babam2 UTSW 5 31785611 missense probably damaging 1.00
R5982:Babam2 UTSW 5 31820620 missense possibly damaging 0.86
R6271:Babam2 UTSW 5 32001362 missense probably damaging 1.00
R7268:Babam2 UTSW 5 31701853 missense probably damaging 1.00
R7352:Babam2 UTSW 5 32007250 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTGTGGCTCCAATTGTCAT -3'
(R):5'- ATACATAAGTGGTTGCCATCATTTT -3'

Sequencing Primer
(F):5'- GTCATGTACCCAGCATTCTGAGTTAG -3'
(R):5'- TGGTTGCCATCATTTTTATTATTGAC -3'
Posted On2014-06-23