Incidental Mutation 'R0111:Clec4d'
ID20450
Institutional Source Beutler Lab
Gene Symbol Clec4d
Ensembl Gene ENSMUSG00000030144
Gene NameC-type lectin domain family 4, member d
SynonymsClecsf8, mcl, Mpcl, mMCL
MMRRC Submission 038397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0111 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location123262111-123275265 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 123268047 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 95 (Y95*)
Ref Sequence ENSEMBL: ENSMUSP00000032240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032240] [ENSMUST00000204826]
Predicted Effect probably null
Transcript: ENSMUST00000032240
AA Change: Y95*
SMART Domains Protein: ENSMUSP00000032240
Gene: ENSMUSG00000030144
AA Change: Y95*

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 83 207 1.59e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203421
Predicted Effect probably benign
Transcript: ENSMUST00000204826
SMART Domains Protein: ENSMUSP00000145134
Gene: ENSMUSG00000030144

DomainStartEndE-ValueType
Blast:CLECT 28 77 1e-8 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to trehalose-6,60'-dimycolate treatment. Mice homozygous for a different knock-out allele exhibit increased susceptibility to pneumonia infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A T 17: 55,817,073 H491L possibly damaging Het
Adgrg3 T C 8: 95,035,110 probably benign Het
Arhgap5 T C 12: 52,559,960 probably benign Het
Asic1 T C 15: 99,696,983 Y334H probably damaging Het
Calcr T A 6: 3,717,157 D101V probably damaging Het
Cdh2 A T 18: 16,774,509 N57K probably benign Het
Cracr2a A G 6: 127,604,061 T67A probably benign Het
Dennd5a A T 7: 109,934,754 V53D probably damaging Het
Dnah7a T C 1: 53,468,684 D3076G probably benign Het
Espnl T C 1: 91,344,742 M608T probably benign Het
Fam149a C T 8: 45,341,146 probably benign Het
Fam35a T C 14: 34,267,729 K407E probably damaging Het
Fam46c T C 3: 100,472,786 D218G probably damaging Het
Flnc T C 6: 29,454,340 V1884A probably damaging Het
Helz2 A C 2: 181,237,802 S674R probably benign Het
Hoxa2 T G 6: 52,164,487 probably null Het
Ifi47 T A 11: 49,096,070 N221K probably damaging Het
Ipo9 A G 1: 135,405,924 V340A probably damaging Het
Kalrn A T 16: 34,031,590 N373K probably damaging Het
Kif26a T C 12: 112,163,337 probably benign Het
Kiss1r A G 10: 79,918,689 T6A possibly damaging Het
Lama1 A T 17: 67,737,498 I131F probably damaging Het
Nefm T C 14: 68,124,542 D91G probably benign Het
Nos3 C T 5: 24,372,704 T572I probably damaging Het
Notch2 T C 3: 98,138,761 F1710L probably benign Het
Olfr70 T C 4: 43,696,648 N175S probably damaging Het
Olfr804 T A 10: 129,705,277 I133N probably damaging Het
Ostm1 T C 10: 42,679,258 L92P probably damaging Het
Pcdh15 T A 10: 74,626,819 Y1445* probably null Het
Pde1b T C 15: 103,503,513 S14P probably benign Het
Pitpna T C 11: 75,625,484 V265A probably benign Het
Plec G T 15: 76,178,646 T2476K probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppp3cc C T 14: 70,256,359 probably null Het
Prss36 A G 7: 127,934,545 L530P probably damaging Het
Ptpn13 T C 5: 103,580,763 probably benign Het
Ptpn23 T C 9: 110,385,623 D1570G probably damaging Het
Rab42 T C 4: 132,302,365 D182G possibly damaging Het
Rbm27 T A 18: 42,305,672 probably benign Het
Rp1 T C 1: 4,344,760 E2043G probably damaging Het
Rufy3 C T 5: 88,630,584 S341F probably damaging Het
Samd9l C T 6: 3,374,946 V772I possibly damaging Het
Scaper A G 9: 55,602,790 M654T probably benign Het
Sipa1l3 G A 7: 29,348,318 P333S probably damaging Het
Slc30a10 C A 1: 185,455,547 R162S probably benign Het
Spryd3 A T 15: 102,128,537 probably null Het
Tas2r110 T C 6: 132,868,203 F66L probably benign Het
Thap2 T C 10: 115,372,627 N196S probably benign Het
Themis2 C A 4: 132,789,925 R88L probably benign Het
Trip12 A T 1: 84,759,133 probably benign Het
Ube3b T A 5: 114,390,376 probably benign Het
Usp20 T A 2: 31,002,612 H64Q probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r15 T C 5: 109,287,156 R561G possibly damaging Het
Vsig10l A G 7: 43,468,101 D604G probably damaging Het
Wdr90 A G 17: 25,848,444 probably benign Het
Xirp2 A T 2: 67,508,378 N321I probably damaging Het
Zfp595 A G 13: 67,320,920 F11S possibly damaging Het
Zfp953 T A 13: 67,343,075 H271L probably damaging Het
Other mutations in Clec4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Clec4d APN 6 123274773 missense probably damaging 1.00
R0157:Clec4d UTSW 6 123267136 missense probably benign 0.00
R1756:Clec4d UTSW 6 123267109 missense probably damaging 0.99
R1928:Clec4d UTSW 6 123267161 splice site probably null
R1964:Clec4d UTSW 6 123262360 missense probably benign 0.05
R2208:Clec4d UTSW 6 123265355 missense probably damaging 0.98
R2443:Clec4d UTSW 6 123268117 missense probably benign 0.32
R4740:Clec4d UTSW 6 123268113 missense probably damaging 1.00
R5101:Clec4d UTSW 6 123267112 missense probably damaging 1.00
R5692:Clec4d UTSW 6 123268145 critical splice donor site probably null
R5785:Clec4d UTSW 6 123274770 missense probably benign 0.09
R5903:Clec4d UTSW 6 123267061 missense probably damaging 0.98
R6005:Clec4d UTSW 6 123267159 missense probably damaging 0.99
R6209:Clec4d UTSW 6 123270529 intron probably null
R7760:Clec4d UTSW 6 123270341 missense probably benign 0.01
R7867:Clec4d UTSW 6 123267164 critical splice donor site probably null
R7950:Clec4d UTSW 6 123267164 critical splice donor site probably null
Z1176:Clec4d UTSW 6 123274686 missense probably benign 0.01
Z1177:Clec4d UTSW 6 123268074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTACCATTGAGTCACACTGCTA -3'
(R):5'- GAAGAAAAGGCTTCCCAGGCTGAT -3'

Sequencing Primer
(F):5'- CAAAAGCAAAATAGATGTAGAGACAC -3'
(R):5'- gctaagtgtgagtctttgagtg -3'
Posted On2013-04-11