Mutagenetix > Incidental Mutations

Incidental Mutation 'R1817:Galnt7'

204505

Institutional Source

Beutler Lab

Gene Symbol

Galnt7

Ensembl Gene

ENSMUSG00000031608

Gene Name

polypeptide N-acetylgalactosaminyltransferase 7

Synonyms

ppGaNTase-T7

MMRRC Submission

039845-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R1817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57523828-57653032 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 57538178 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 433 (V433M)

Ref Sequence

ENSEMBL: ENSMUSP00000105945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034021
AA Change: V433M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: V433M

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	3e-28	PFAM
Pfam:Glyco_tranf_2_2	210	490	2e-7	PFAM
Pfam:Glyco_transf_7C	375	445	1.8e-8	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110316
AA Change: V433M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: V433M

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	8.2e-27	PFAM
Pfam:Glyco_tranf_2_2	210	490	1.3e-7	PFAM
Pfam:Glyco_transf_7C	369	445	9.3e-9	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156907

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 91.9%

Validation Efficiency

95% (90/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,219,318	S600T	probably benign	Het
Acly	T	A	11: 100,495,891	Q615L	probably benign	Het
Adgrf1	C	A	17: 43,310,033	T387K	probably benign	Het
Afg3l1	G	T	8: 123,501,931	K745N	probably damaging	Het
Armc8	T	C	9: 99,536,259	T39A	possibly damaging	Het
Atm	C	A	9: 53,492,233		probably benign	Het
Babam2	A	G	5: 32,057,546	T324A	probably damaging	Het
Btd	C	A	14: 31,662,289	D77E	possibly damaging	Het
Cadm1	T	A	9: 47,829,370		probably benign	Het
Card11	A	T	5: 140,885,560	D729E	probably benign	Het
Ccni	G	T	5: 93,188,108	T144K	possibly damaging	Het
Cecr2	A	G	6: 120,731,267	T77A	probably damaging	Het
Cpsf7	T	C	19: 10,535,439	F296L	possibly damaging	Het
Cyfip1	C	A	7: 55,873,448	N70K	possibly damaging	Het
Cyp4a12b	A	G	4: 115,414,062		probably benign	Het
Ddx20	A	T	3: 105,678,580	Y816*	probably null	Het
Ddx59	A	G	1: 136,432,507	I420V	probably damaging	Het
Dgat1	T	A	15: 76,502,503	M445L	probably damaging	Het
Dnah5	T	A	15: 28,246,400	L628*	probably null	Het
Dnah7a	A	C	1: 53,559,148	D1409E	probably benign	Het
Dnmt1	T	C	9: 20,927,126	T215A	probably benign	Het
Dsg4	C	T	18: 20,471,245	T923M	probably damaging	Het
Enox1	A	G	14: 77,615,475	I394V	possibly damaging	Het
Esrp2	A	T	8: 106,134,618	M183K	probably damaging	Het
Fam171a1	C	T	2: 3,178,373	P79S	probably benign	Het
Fga	A	G	3: 83,031,775	T486A	probably benign	Het
Fkbp10	G	T	11: 100,415,889	A36S	probably benign	Het
Fnip1	A	G	11: 54,502,453	T572A	probably benign	Het
Fxn	A	C	19: 24,280,401		probably null	Het
Gaa	C	T	11: 119,284,498	Q901*	probably null	Het
Gabrg1	A	G	5: 70,754,251	M344T	probably benign	Het
Gin1	A	G	1: 97,785,226		probably null	Het
Gm5155	C	T	7: 17,873,330		noncoding transcript	Het
Hydin	A	C	8: 110,532,827	D2477A	probably benign	Het
Igsf6	T	C	7: 121,070,808	Y37C	probably damaging	Het
Il18rap	A	G	1: 40,531,527	I210V	probably benign	Het
Kif3a	T	C	11: 53,598,734	Y138H	probably damaging	Het
Klra17	A	G	6: 129,868,718		probably null	Het
Lcorl	A	T	5: 45,795,346	I55N	probably damaging	Het
Lrrc49	A	G	9: 60,602,776	S398P	possibly damaging	Het
Ltv1	A	G	10: 13,179,274	L384S	probably damaging	Het
Mageb3	A	T	2: 121,954,437	Y261*	probably null	Het
Mb21d1	A	G	9: 78,434,311		probably null	Het
Mical3	T	G	6: 121,042,235	T9P	probably benign	Het
Mpp6	T	G	6: 50,163,431	F144V	probably benign	Het
Myrip	C	T	9: 120,388,162	S49L	probably damaging	Het
Nrap	T	C	19: 56,384,055		probably benign	Het
Olfr164	T	C	16: 19,285,877	N289D	probably damaging	Het
Olfr729	A	G	14: 50,148,271	V201A	probably benign	Het
Otoa	A	T	7: 121,160,530		probably benign	Het
Parp11	T	A	6: 127,490,045	I133N	probably damaging	Het
Pcnx	A	G	12: 81,918,642	T528A	probably benign	Het
Pde4c	A	G	8: 70,726,989	H63R	probably benign	Het
Pdpk1	T	C	17: 24,110,904	K53E	probably damaging	Het
Pdzd7	A	T	19: 45,036,176	M468K	probably damaging	Het
Perm1	C	A	4: 156,218,604	P535Q	possibly damaging	Het
Pgap1	C	A	1: 54,535,969	A265S	probably benign	Het
Pik3c2a	A	T	7: 116,376,512		probably null	Het
Plxnd1	T	C	6: 115,980,601	T491A	possibly damaging	Het
Pms1	A	T	1: 53,206,969	D470E	probably benign	Het
Prf1	C	A	10: 61,302,983	T240N	probably damaging	Het
Prune2	A	G	19: 17,122,081	T1650A	probably benign	Het
Ptprf	A	G	4: 118,223,265	L1264P	probably benign	Het
Ptprs	A	G	17: 56,419,527	S948P	probably damaging	Het
Rapgef1	T	C	2: 29,686,256	V117A	probably damaging	Het
Rnf123	A	G	9: 108,062,926	V756A	probably benign	Het
Sez6l2	A	G	7: 126,967,119	E741G	probably damaging	Het
Shc3	A	T	13: 51,472,852	I125K	possibly damaging	Het
Smr3a	A	T	5: 88,008,058		probably benign	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
St6gal1	A	T	16: 23,321,333	K85*	probably null	Het
Taf1b	T	G	12: 24,547,122	D353E	possibly damaging	Het
Tcp10b	C	T	17: 13,067,703	P180S	possibly damaging	Het
Tlr9	A	T	9: 106,224,943	M478L	probably benign	Het
Tpr	A	T	1: 150,419,903	E892D	probably damaging	Het
Trio	C	T	15: 27,742,495	W22*	probably null	Het
Usp14	A	G	18: 10,024,673	V8A	probably damaging	Het
Vmn2r19	A	T	6: 123,330,052	K506N	possibly damaging	Het
Vmn2r45	T	A	7: 8,472,373	N552I	probably damaging	Het
Vmn2r56	A	T	7: 12,715,615	M232K	probably benign	Het
Vps13b	T	A	15: 35,910,642	F3517L	possibly damaging	Het
Yif1a	C	T	19: 5,092,305	R247*	probably null	Het
Zbtb5	A	G	4: 44,993,767	V539A	probably benign	Het
Zfp180	G	A	7: 24,105,227	R357Q	probably damaging	Het
Zfp536	A	G	7: 37,568,617	L458P	probably damaging	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zfp970	C	T	2: 177,476,183	H517Y	probably damaging	Het
Zranb3	A	T	1: 128,017,556		probably null	Het

Other mutations in Galnt7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Galnt7	APN	8	57540039	missense	probably damaging	1.00
IGL00538:Galnt7	APN	8	57552522	missense	possibly damaging	0.95
IGL00826:Galnt7	APN	8	57540071	nonsense	probably null
IGL00951:Galnt7	APN	8	57583824	missense	probably damaging	0.96
IGL01662:Galnt7	APN	8	57531735	splice site	probably benign
IGL02280:Galnt7	APN	8	57536790	missense	probably damaging	1.00
IGL02832:Galnt7	APN	8	57552497	missense	probably damaging	1.00
IGL02936:Galnt7	APN	8	57584214	missense	probably benign
IGL03083:Galnt7	APN	8	57526189	missense	probably damaging	0.98
IGL03387:Galnt7	APN	8	57526178	missense	probably benign	0.01
R0400:Galnt7	UTSW	8	57583989	missense	probably damaging	0.99
R0553:Galnt7	UTSW	8	57552430	splice site	probably benign
R1463:Galnt7	UTSW	8	57652858	missense	probably benign
R1487:Galnt7	UTSW	8	57540039	missense	probably damaging	1.00
R1791:Galnt7	UTSW	8	57542530	missense	probably benign	0.05
R1962:Galnt7	UTSW	8	57532714	missense	probably benign	0.13
R3855:Galnt7	UTSW	8	57532624	splice site	probably benign
R3856:Galnt7	UTSW	8	57532624	splice site	probably benign
R4232:Galnt7	UTSW	8	57652966	missense	probably benign
R4396:Galnt7	UTSW	8	57538181	missense	probably damaging	1.00
R4426:Galnt7	UTSW	8	57552572	nonsense	probably null
R4610:Galnt7	UTSW	8	57545769	missense	probably damaging	0.99
R4745:Galnt7	UTSW	8	57542727	intron	probably benign
R4794:Galnt7	UTSW	8	57545363	missense	probably damaging	1.00
R5014:Galnt7	UTSW	8	57545380	missense	probably damaging	1.00
R5177:Galnt7	UTSW	8	57584027	missense	possibly damaging	0.87
R5682:Galnt7	UTSW	8	57583933	nonsense	probably null
R6122:Galnt7	UTSW	8	57526166	missense	probably damaging	0.99
R6276:Galnt7	UTSW	8	57536578	splice site	probably null
R6684:Galnt7	UTSW	8	57538109	missense	probably benign	0.16
R6752:Galnt7	UTSW	8	57652951	missense	probably damaging	1.00
R7464:Galnt7	UTSW	8	57584020	missense	possibly damaging	0.95
R7491:Galnt7	UTSW	8	57552518	missense	probably damaging	0.97
R7547:Galnt7	UTSW	8	57583962	missense	possibly damaging	0.48
R8093:Galnt7	UTSW	8	57532705	missense	probably benign	0.00
R8221:Galnt7	UTSW	8	57552566	missense	possibly damaging	0.93
R8248:Galnt7	UTSW	8	57538188	missense	probably benign	0.34
R8402:Galnt7	UTSW	8	57542919	missense	probably damaging	0.98
X0050:Galnt7	UTSW	8	57552444	frame shift	probably null
X0062:Galnt7	UTSW	8	57583908	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCATAAATACTTCCACTCCTTGTAG -3'
(R):5'- GAGTAACTCACTGCTTACCTCAC -3'

Sequencing Primer
(F):5'- TCACCTTCAGAGTTGGAG -3'
(R):5'- ACTTGTGTTTCTAACGTAATGGAC -3'

Posted On

2014-06-23