Incidental Mutation 'R1817:Lrrc49'
ID204514
Institutional Source Beutler Lab
Gene Symbol Lrrc49
Ensembl Gene ENSMUSG00000047766
Gene Nameleucine rich repeat containing 49
SynonymsD430025H09Rik
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location60568859-60688158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60602776 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000109666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053171] [ENSMUST00000065603] [ENSMUST00000114032] [ENSMUST00000114034] [ENSMUST00000150060] [ENSMUST00000166168]
Predicted Effect probably benign
Transcript: ENSMUST00000053171
AA Change: S110P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000057014
Gene: ENSMUSG00000047766
AA Change: S110P

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065603
AA Change: S470P

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070606
Gene: ENSMUSG00000047766
AA Change: S470P

DomainStartEndE-ValueType
LRR 199 221 2.84e1 SMART
LRR 243 264 1.49e1 SMART
LRR 265 286 1.37e2 SMART
LRR 287 308 1.62e1 SMART
LRR 309 332 6.77e0 SMART
low complexity region 378 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114032
AA Change: S398P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109666
Gene: ENSMUSG00000047766
AA Change: S398P

DomainStartEndE-ValueType
LRR 127 149 2.84e1 SMART
LRR 171 192 1.49e1 SMART
LRR 193 214 1.37e2 SMART
LRR 215 236 1.62e1 SMART
LRR 237 260 6.77e0 SMART
low complexity region 306 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114034
AA Change: S404P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109668
Gene: ENSMUSG00000047766
AA Change: S404P

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136388
Predicted Effect probably benign
Transcript: ENSMUST00000150060
SMART Domains Protein: ENSMUSP00000118205
Gene: ENSMUSG00000047766

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166168
AA Change: S464P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128842
Gene: ENSMUSG00000047766
AA Change: S464P

DomainStartEndE-ValueType
LRR 193 215 2.84e1 SMART
LRR 237 258 1.49e1 SMART
LRR 259 280 1.37e2 SMART
LRR 281 302 1.62e1 SMART
LRR 303 326 6.77e0 SMART
low complexity region 372 388 N/A INTRINSIC
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Lrrc49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lrrc49 APN 9 60601320 missense probably damaging 1.00
IGL00468:Lrrc49 APN 9 60687868 unclassified probably benign
IGL00792:Lrrc49 APN 9 60687838 missense probably damaging 0.97
IGL02252:Lrrc49 APN 9 60687859 start codon destroyed probably benign 0.04
IGL02830:Lrrc49 APN 9 60685110 missense probably damaging 1.00
IGL03103:Lrrc49 APN 9 60685033 critical splice donor site probably null
IGL03223:Lrrc49 APN 9 60687845 missense possibly damaging 0.72
IGL03244:Lrrc49 APN 9 60587857 missense probably damaging 1.00
IGL03392:Lrrc49 APN 9 60666280 splice site probably benign
IGL02837:Lrrc49 UTSW 9 60610322 missense probably benign 0.00
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0335:Lrrc49 UTSW 9 60677095 missense probably damaging 0.99
R0399:Lrrc49 UTSW 9 60610246 splice site probably benign
R0607:Lrrc49 UTSW 9 60666357 missense probably benign 0.35
R1396:Lrrc49 UTSW 9 60680527 missense probably damaging 0.99
R1731:Lrrc49 UTSW 9 60621631 missense probably damaging 1.00
R1800:Lrrc49 UTSW 9 60598191 missense probably damaging 1.00
R1876:Lrrc49 UTSW 9 60587777 missense possibly damaging 0.77
R1925:Lrrc49 UTSW 9 60649490 missense probably benign 0.07
R2172:Lrrc49 UTSW 9 60602682 missense probably benign 0.25
R2233:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2235:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2927:Lrrc49 UTSW 9 60593746 nonsense probably null
R3955:Lrrc49 UTSW 9 60671359 missense probably damaging 1.00
R4214:Lrrc49 UTSW 9 60666326 missense probably benign 0.33
R4772:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R5283:Lrrc49 UTSW 9 60687178 missense probably benign 0.06
R5801:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6115:Lrrc49 UTSW 9 60615161 missense possibly damaging 0.61
R6488:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6525:Lrrc49 UTSW 9 60598149 missense probably damaging 1.00
R6540:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R6550:Lrrc49 UTSW 9 60677147 missense probably benign 0.13
R6603:Lrrc49 UTSW 9 60593769 splice site probably null
R6878:Lrrc49 UTSW 9 60680148 missense probably damaging 0.99
R7144:Lrrc49 UTSW 9 60615156 missense probably damaging 0.99
R7336:Lrrc49 UTSW 9 60677191 missense possibly damaging 0.92
R7541:Lrrc49 UTSW 9 60610403 missense probably damaging 1.00
R7608:Lrrc49 UTSW 9 60602722 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTTGGGAAGTACTTGGAC -3'
(R):5'- CAGGAAGAGGCTCAACATCG -3'

Sequencing Primer
(F):5'- GGGAAGTACTTGGACAATTTCATC -3'
(R):5'- CCACAACAAGCCTGTTACTTTG -3'
Posted On2014-06-23