Incidental Mutation 'R1817:Prf1'
List |< first << previous [record 62 of 89] next >> last >|
ID204521
Institutional Source Beutler Lab
Gene Symbol Prf1
Ensembl Gene ENSMUSG00000037202
Gene Nameperforin 1 (pore forming protein)
SynonymsPfn, Prf-1, perforin, Pfp
MMRRC Submission 039845-MU
Accession Numbers

Ncbi RefSeq: NM_011073; MGI: 97551

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61297833-61304680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61302983 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 240 (T240N)
Ref Sequence ENSEMBL: ENSMUSP00000151354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035419] [ENSMUST00000219375]
Predicted Effect probably damaging
Transcript: ENSMUST00000035419
AA Change: T240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041483
Gene: ENSMUSG00000037202
AA Change: T240N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MACPF 165 368 1.84e-80 SMART
C2 415 516 1.59e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000219375
AA Change: T240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6323 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has structural and functional similarities to complement component 9 (C9). Like C9, this protein creates transmembrane tubules and is capable of lysing non-specifically a variety of target cells. This protein is one of the main cytolytic proteins of cytolytic granules, and it is known to be a key effector molecule for T-cell- and natural killer-cell-mediated cytolysis. Defects in this gene cause familial hemophagocytic lymphohistiocytosis type 2 (HPLH2), a rare and lethal autosomal recessive disorder of early childhood. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit increased susceptibility to viral infection and defective cytotoxic T cell cytolysis and NK cell cytolysis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Prf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Prf1 APN 10 61300178 missense probably benign
prime UTSW 10 61303722 nonsense probably null
PIT4802001:Prf1 UTSW 10 61300193 missense probably benign 0.01
R0526:Prf1 UTSW 10 61300254 missense probably benign 0.01
R0594:Prf1 UTSW 10 61303722 nonsense probably null
R1237:Prf1 UTSW 10 61303649 missense probably benign 0.00
R1508:Prf1 UTSW 10 61303550 missense probably damaging 1.00
R1553:Prf1 UTSW 10 61303169 missense probably damaging 1.00
R1665:Prf1 UTSW 10 61302887 missense probably benign 0.29
R1716:Prf1 UTSW 10 61300452 missense probably benign 0.01
R1818:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R2014:Prf1 UTSW 10 61303895 missense probably benign 0.41
R2307:Prf1 UTSW 10 61303163 missense possibly damaging 0.80
R2901:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R2902:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R4724:Prf1 UTSW 10 61303708 missense probably damaging 1.00
R4781:Prf1 UTSW 10 61300424 missense probably damaging 1.00
R5327:Prf1 UTSW 10 61300258 missense probably benign 0.00
R5850:Prf1 UTSW 10 61300193 missense probably benign 0.00
R5999:Prf1 UTSW 10 61303028 missense probably damaging 1.00
R7356:Prf1 UTSW 10 61303280 missense possibly damaging 0.61
R7508:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
R7714:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
R7716:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCACAGTTTTCGCCTGGTAC -3'
(R):5'- ATCATGCGTGGAGTCCAGAG -3'

Sequencing Primer
(F):5'- GTTTTCGCCTGGTACAAAAACC -3'
(R):5'- AAGTACTTCGACGTGACGCTC -3'
Posted On2014-06-23