Incidental Mutation 'R1817:Fkbp10'
ID204524
Institutional Source Beutler Lab
Gene Symbol Fkbp10
Ensembl Gene ENSMUSG00000001555
Gene NameFK506 binding protein 10
SynonymsFkbp6, Fkbp-rs1, Fkbp1-rs, FKBP65, 65kDa
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1817 (G1)
Quality Score215
Status Validated
Chromosome11
Chromosomal Location100415697-100424824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100415889 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 36 (A36S)
Ref Sequence ENSEMBL: ENSMUSP00000001595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001595] [ENSMUST00000066489] [ENSMUST00000107400]
Predicted Effect probably benign
Transcript: ENSMUST00000001595
AA Change: A36S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000001595
Gene: ENSMUSG00000001555
AA Change: A36S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 5.4e-30 PFAM
Pfam:FKBP_C 166 258 4e-29 PFAM
Pfam:FKBP_C 278 370 2.3e-28 PFAM
Pfam:FKBP_C 391 482 6.2e-26 PFAM
EFh 503 528 2.16e0 SMART
EFh 545 573 2.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066489
SMART Domains Protein: ENSMUSP00000065278
Gene: ENSMUSG00000006931

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
internal_repeat_1 151 215 5.16e-8 PROSPERO
internal_repeat_1 302 364 5.16e-8 PROSPERO
low complexity region 385 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107400
AA Change: A36S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103023
Gene: ENSMUSG00000001555
AA Change: A36S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 1.4e-29 PFAM
Pfam:FKBP_C 166 258 2e-29 PFAM
Pfam:FKBP_C 279 370 4.9e-26 PFAM
EFh 391 416 2.16e0 SMART
EFh 433 461 2.04e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000134815
AA Change: A15S
SMART Domains Protein: ENSMUSP00000123577
Gene: ENSMUSG00000001555
AA Change: A15S

DomainStartEndE-ValueType
Pfam:FKBP_C 34 65 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139084
Predicted Effect probably benign
Transcript: ENSMUST00000141840
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice do not survive birth, and embryos exhibit delayed growth, tissue fragility, decreased aorta wall thickness, craniofacial and forelimb anomalies, and connective tissue alterations. Mutant MEFs retain procollagen in the cell layer and show dilated endoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Fkbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Fkbp10 APN 11 100421817 missense probably benign 0.00
IGL02390:Fkbp10 APN 11 100416017 missense probably damaging 1.00
IGL02424:Fkbp10 APN 11 100415956 missense probably damaging 1.00
IGL02728:Fkbp10 APN 11 100415977 missense probably damaging 1.00
IGL02737:Fkbp10 APN 11 100422655 missense probably benign 0.25
IGL03143:Fkbp10 APN 11 100422754 missense probably benign 0.06
R0479:Fkbp10 UTSW 11 100415914 missense probably damaging 1.00
R1733:Fkbp10 UTSW 11 100423931 missense probably benign 0.20
R1819:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1831:Fkbp10 UTSW 11 100423219 missense probably damaging 1.00
R1997:Fkbp10 UTSW 11 100416015 missense probably damaging 1.00
R2017:Fkbp10 UTSW 11 100421673 missense possibly damaging 0.77
R3758:Fkbp10 UTSW 11 100422625 critical splice acceptor site probably null
R5163:Fkbp10 UTSW 11 100423099 missense probably benign 0.03
R5437:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R5666:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5696:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5698:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5706:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R7084:Fkbp10 UTSW 11 100421303 missense possibly damaging 0.56
R7405:Fkbp10 UTSW 11 100415881 missense probably damaging 1.00
R7780:Fkbp10 UTSW 11 100421222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCAGAGACTCTCAACCTGG -3'
(R):5'- AGGAAAGTGGTGCTGAGTCC -3'

Sequencing Primer
(F):5'- ATTCCACGTGGACCCGC -3'
(R):5'- TGCTGAGTCCGGGAGTGC -3'
Posted On2014-06-23