Incidental Mutation 'R1817:Olfr729'
ID204532
Institutional Source Beutler Lab
Gene Symbol Olfr729
Ensembl Gene ENSMUSG00000049011
Gene Nameolfactory receptor 729
SynonymsMOR246-6, GA_x6K02T2PMLR-5839874-5838903
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50144731-50152910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50148271 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000149189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061020] [ENSMUST00000213163] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect probably benign
Transcript: ENSMUST00000061020
AA Change: V201A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051755
Gene: ENSMUSG00000049011
AA Change: V201A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.4e-5 PFAM
Pfam:7tm_1 41 287 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
AA Change: V201A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215327
AA Change: V201A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215451
AA Change: V201A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Olfr729
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Olfr729 APN 14 50148716 missense probably benign 0.38
IGL02736:Olfr729 APN 14 50148424 missense probably benign 0.01
IGL02798:Olfr729 APN 14 50148378 missense probably benign
IGL03267:Olfr729 APN 14 50148847 missense probably damaging 1.00
R0082:Olfr729 UTSW 14 50148055 missense probably damaging 0.97
R0225:Olfr729 UTSW 14 50148635 missense probably damaging 1.00
R0503:Olfr729 UTSW 14 50148478 missense probably damaging 1.00
R1022:Olfr729 UTSW 14 50147927 missense probably benign
R1024:Olfr729 UTSW 14 50147927 missense probably benign
R1424:Olfr729 UTSW 14 50148465 missense possibly damaging 0.83
R1440:Olfr729 UTSW 14 50148358 missense probably damaging 1.00
R1479:Olfr729 UTSW 14 50148788 missense probably benign 0.00
R1583:Olfr729 UTSW 14 50148774 missense probably benign 0.00
R2155:Olfr729 UTSW 14 50148697 missense probably damaging 1.00
R2282:Olfr729 UTSW 14 50148319 missense probably benign
R2926:Olfr729 UTSW 14 50148436 missense probably benign 0.19
R3790:Olfr729 UTSW 14 50148569 missense possibly damaging 0.51
R4073:Olfr729 UTSW 14 50148043 missense possibly damaging 0.55
R5945:Olfr729 UTSW 14 50148763 missense probably benign
R6714:Olfr729 UTSW 14 50148214 missense possibly damaging 0.95
R7112:Olfr729 UTSW 14 50147935 missense probably benign 0.00
R7157:Olfr729 UTSW 14 50148232 missense probably damaging 1.00
R7511:Olfr729 UTSW 14 50148256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCACACATAAATGAAGATG -3'
(R):5'- TGGCCATATGCAAACCTCTAC -3'

Sequencing Primer
(F):5'- CCACACATAAATGAAGATGCAAGG -3'
(R):5'- CCAAACTACATGTACTGCCTTGGTAG -3'
Posted On2014-06-23