Incidental Mutation 'R1817:Dgat1'
ID204539
Institutional Source Beutler Lab
Gene Symbol Dgat1
Ensembl Gene ENSMUSG00000022555
Gene Namediacylglycerol O-acyltransferase 1
SynonymsD15Ertd23e
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76502015-76511953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76502503 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 445 (M445L)
Ref Sequence ENSEMBL: ENSMUSP00000023214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000228868] [ENSMUST00000229363]
Predicted Effect probably damaging
Transcript: ENSMUST00000023214
AA Change: M445L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555
AA Change: M445L

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160293
SMART Domains Protein: ENSMUSP00000123779
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
Pfam:MBOAT 41 201 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162813
Predicted Effect probably benign
Transcript: ENSMUST00000226238
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
Predicted Effect probably benign
Transcript: ENSMUST00000227478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227921
Predicted Effect probably benign
Transcript: ENSMUST00000228371
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228720
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228781
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect probably benign
Transcript: ENSMUST00000229363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231035
Meta Mutation Damage Score 0.7727 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an multipass transmembrane protein that functions as a key metabolic enzyme. The encoded protein catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol. This enzyme can also transfer acyl CoA to retinol. Activity of this protein may be associated with obesity and other metabolic diseases. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased percent body fat, resistance to diet-induced obesity, altered energy, glucose and triglyceride metabolism, alopecia, hair cycle and skin defects, and a lactation failure associated with impaired mammary gland growth during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Dgat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Dgat1 APN 15 76503041 missense probably damaging 1.00
IGL02713:Dgat1 APN 15 76503534 missense probably damaging 1.00
R0510:Dgat1 UTSW 15 76511567 missense possibly damaging 0.85
R0894:Dgat1 UTSW 15 76502999 missense possibly damaging 0.55
R1525:Dgat1 UTSW 15 76511586 missense probably benign
R1682:Dgat1 UTSW 15 76503019 missense probably benign 0.03
R1740:Dgat1 UTSW 15 76502729 missense probably damaging 1.00
R2352:Dgat1 UTSW 15 76502313 missense possibly damaging 0.66
R3012:Dgat1 UTSW 15 76503393 missense possibly damaging 0.90
R3154:Dgat1 UTSW 15 76502521 missense probably benign 0.27
R4059:Dgat1 UTSW 15 76504171 missense possibly damaging 0.79
R4593:Dgat1 UTSW 15 76504689 missense probably damaging 1.00
R5503:Dgat1 UTSW 15 76502194 unclassified probably benign
R5818:Dgat1 UTSW 15 76502207 unclassified probably benign
R5984:Dgat1 UTSW 15 76502258 missense probably damaging 1.00
R6228:Dgat1 UTSW 15 76503293 missense possibly damaging 0.89
R7352:Dgat1 UTSW 15 76502824 nonsense probably null
R7625:Dgat1 UTSW 15 76503195 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCAATGATGAGTGTCACCCAC -3'
(R):5'- ATGCTCAGACATGGCAGCAG -3'

Sequencing Primer
(F):5'- ACACAGCTGCATTGCCATAGTTC -3'
(R):5'- CCAGGACAGGAGTATTTTTGACCTC -3'
Posted On2014-06-23