Incidental Mutation 'R1817:Cpsf7'
ID204549
Institutional Source Beutler Lab
Gene Symbol Cpsf7
Ensembl Gene ENSMUSG00000034820
Gene Namecleavage and polyadenylation specific factor 7
SynonymsC330017N18Rik, 5730453I16Rik
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1817 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10525244-10547735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10535439 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 296 (F296L)
Ref Sequence ENSEMBL: ENSMUSP00000038958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038379] [ENSMUST00000123788] [ENSMUST00000145210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038379
AA Change: F296L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820
AA Change: F296L

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
RRM 83 158 7.31e-8 SMART
low complexity region 188 202 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 265 291 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 405 439 N/A INTRINSIC
low complexity region 454 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123788
SMART Domains Protein: ENSMUSP00000119596
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 15 123 9.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145210
SMART Domains Protein: ENSMUSP00000123397
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 69 2.8e-21 PFAM
Meta Mutation Damage Score 0.0895 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Cpsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cpsf7 APN 19 10539787 missense probably damaging 0.98
IGL00870:Cpsf7 APN 19 10539650 splice site probably null
IGL01883:Cpsf7 APN 19 10526023 missense possibly damaging 0.69
IGL02406:Cpsf7 APN 19 10531988 missense probably damaging 0.96
IGL02491:Cpsf7 APN 19 10539637 missense possibly damaging 0.92
IGL02990:Cpsf7 APN 19 10531795 missense probably benign
R0003:Cpsf7 UTSW 19 10539629 missense possibly damaging 0.88
R0540:Cpsf7 UTSW 19 10533318 nonsense probably null
R0633:Cpsf7 UTSW 19 10531782 missense probably benign 0.09
R0662:Cpsf7 UTSW 19 10526008 start codon destroyed probably null 0.77
R1309:Cpsf7 UTSW 19 10533467 critical splice donor site probably null
R2004:Cpsf7 UTSW 19 10540709 missense probably damaging 1.00
R2286:Cpsf7 UTSW 19 10535296 missense probably damaging 0.99
R2417:Cpsf7 UTSW 19 10525968 start gained probably benign
R4374:Cpsf7 UTSW 19 10539637 missense probably damaging 1.00
R5788:Cpsf7 UTSW 19 10540718 missense possibly damaging 0.88
R5801:Cpsf7 UTSW 19 10539632 missense probably benign 0.02
R6823:Cpsf7 UTSW 19 10532884 nonsense probably null
R7371:Cpsf7 UTSW 19 10531839 missense probably benign 0.00
R7602:Cpsf7 UTSW 19 10535373 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGTGTTGCCCTACTTTAAC -3'
(R):5'- GGCTGGTCTACATAGTGAGAC -3'

Sequencing Primer
(F):5'- TCAGCCCTTCCCCTAATGG -3'
(R):5'- GGTCTACATAGTGAGACCTTGTCAC -3'
Posted On2014-06-23