Incidental Mutation 'R1817:Pdzd7'
ID204552
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene NamePDZ domain containing 7
SynonymsPdzk7, EG435601
MMRRC Submission 039845-MU
Accession Numbers

Genbank: NM_001195265

Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R1817 (G1)
Quality Score219
Status Validated
Chromosome19
Chromosomal Location45026906-45046614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45036176 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 468 (M468K)
Ref Sequence ENSEMBL: ENSMUSP00000133273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145391] [ENSMUST00000169459]
Predicted Effect probably damaging
Transcript: ENSMUST00000145391
AA Change: M468K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: M468K

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169459
AA Change: M468K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: M468K

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp970 C T 2: 177,476,183 H517Y probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45040258 missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45045643 start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45036734 missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45037072 missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45036090 missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45045475 missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45029305 missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45040685 missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45045511 missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45039228 missense probably damaging 1.00
R2162:Pdzd7 UTSW 19 45036055 critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45027674 missense probably benign
R2852:Pdzd7 UTSW 19 45027674 missense probably benign
R2939:Pdzd7 UTSW 19 45045423 missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45040254 missense probably damaging 1.00
R3874:Pdzd7 UTSW 19 45045628 missense probably benign
R4416:Pdzd7 UTSW 19 45040580 missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45045687 start gained probably benign
R5133:Pdzd7 UTSW 19 45028429 missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45028777 missense probably benign
R5458:Pdzd7 UTSW 19 45027791 missense probably benign
R5480:Pdzd7 UTSW 19 45039285 missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45040180 missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45036989 missense probably benign 0.06
R5812:Pdzd7 UTSW 19 45036871 missense probably damaging 1.00
R5873:Pdzd7 UTSW 19 45027949 missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45036751 missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45027748 missense probably benign
R7128:Pdzd7 UTSW 19 45027949 missense probably damaging 0.99
R7183:Pdzd7 UTSW 19 45037114 missense probably benign
R7378:Pdzd7 UTSW 19 45045606 missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45037011 missense probably damaging 1.00
R7426:Pdzd7 UTSW 19 45033647 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGCAGGGTGGAATTTCAACC -3'
(R):5'- CCTGGAACTGTGTGGTAGAGAG -3'

Sequencing Primer
(F):5'- GTGGAATTTCAACCTGGACCTGC -3'
(R):5'- GAATAGCGGCAGACCCCTACTG -3'
Posted On2014-06-23