Incidental Mutation 'R1818:Inpp5e'
ID 204566
Institutional Source Beutler Lab
Gene Symbol Inpp5e
Ensembl Gene ENSMUSG00000026925
Gene Name inositol polyphosphate-5-phosphatase E
Synonyms 1200002L24Rik, 72kDa
MMRRC Submission 039846-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1818 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 26286261-26299215 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26287886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 637 (S637G)
Ref Sequence ENSEMBL: ENSMUSP00000119485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076431] [ENSMUST00000114090] [ENSMUST00000114093] [ENSMUST00000145701]
AlphaFold Q9JII1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028291
Predicted Effect probably benign
Transcript: ENSMUST00000076431
SMART Domains Protein: ENSMUSP00000075762
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 4.5e-47 PFAM
Pfam:Peptidase_M16_C 231 430 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114090
SMART Domains Protein: ENSMUSP00000109724
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114093
SMART Domains Protein: ENSMUSP00000109727
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 1.6e-47 PFAM
Pfam:Peptidase_M16_C 231 420 9.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131109
SMART Domains Protein: ENSMUSP00000118739
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 4 88 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144011
SMART Domains Protein: ENSMUSP00000123272
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
IPPc 21 206 1.76e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145701
AA Change: S637G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119485
Gene: ENSMUSG00000026925
AA Change: S637G

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150907
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display signs of ciliopathies including prenatal and perinatal lethality, polycystic kidneys, arrest of eye development, abnormalities in primary cilia, cerebral developmental defects, and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,857 (GRCm39) probably null Het
Adam6b T A 12: 113,454,876 (GRCm39) N564K probably benign Het
Ahi1 A G 10: 20,864,461 (GRCm39) Y731C probably damaging Het
Ankk1 A G 9: 49,331,725 (GRCm39) Y190H probably benign Het
Ankmy1 T A 1: 92,814,553 (GRCm39) D318V probably benign Het
Ankrd33b G A 15: 31,367,267 (GRCm39) A91V probably damaging Het
Ap3b1 A G 13: 94,608,212 (GRCm39) N561S possibly damaging Het
Apob A G 12: 8,056,834 (GRCm39) N1739S probably damaging Het
Apob A G 12: 8,063,064 (GRCm39) T236A possibly damaging Het
Birc6 G A 17: 74,956,844 (GRCm39) A3593T probably damaging Het
Bnc2 A G 4: 84,210,111 (GRCm39) F778L possibly damaging Het
Capn2 T A 1: 182,300,162 (GRCm39) K609N probably benign Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Card11 A T 5: 140,871,315 (GRCm39) D729E probably benign Het
Ccl20 A G 1: 83,095,529 (GRCm39) Y30C probably damaging Het
Cd209a G A 8: 3,795,576 (GRCm39) T106I probably damaging Het
Cebpz A G 17: 79,242,805 (GRCm39) L283P probably damaging Het
Cecr2 A G 6: 120,708,228 (GRCm39) T77A probably damaging Het
Clec4e T A 6: 123,262,452 (GRCm39) D155V possibly damaging Het
Col25a1 G A 3: 130,379,386 (GRCm39) probably null Het
Cyp2j11 A T 4: 96,185,976 (GRCm39) V403D probably damaging Het
Cyp4v3 G A 8: 45,768,673 (GRCm39) R296C possibly damaging Het
Ddx59 A G 1: 136,360,245 (GRCm39) I420V probably damaging Het
Denr T A 5: 124,055,283 (GRCm39) D49E probably benign Het
Dnaaf3 A T 7: 4,526,568 (GRCm39) probably null Het
Dnaaf3 G T 7: 4,526,569 (GRCm39) L503M probably benign Het
Dnah7a A C 1: 53,598,307 (GRCm39) D1409E probably benign Het
Dnai4 A G 4: 102,929,854 (GRCm39) V56A possibly damaging Het
Efcab3 T A 11: 104,612,333 (GRCm39) L652Q probably benign Het
Ehd4 C T 2: 119,932,885 (GRCm39) W180* probably null Het
Ephb2 A G 4: 136,382,647 (GRCm39) S984P probably benign Het
Eva1a T C 6: 82,048,125 (GRCm39) M1T probably null Het
Fam90a1a C G 8: 22,453,787 (GRCm39) P381A possibly damaging Het
Fam90a1a C A 8: 22,453,788 (GRCm39) P381Q probably damaging Het
Flnc T C 6: 29,457,447 (GRCm39) Y2382H probably damaging Het
Flrt1 A T 19: 7,072,711 (GRCm39) L612Q probably damaging Het
Fubp1 T A 3: 151,927,806 (GRCm39) N419K probably damaging Het
Gin1 A G 1: 97,712,951 (GRCm39) probably null Het
Gm4847 T A 1: 166,465,788 (GRCm39) H267L probably damaging Het
Golga4 T G 9: 118,402,055 (GRCm39) V91G probably damaging Het
Hip1r T C 5: 124,134,018 (GRCm39) probably null Het
Ice2 A G 9: 69,339,383 (GRCm39) S967G probably benign Het
Il18rap A G 1: 40,570,687 (GRCm39) I210V probably benign Het
Impdh2 T G 9: 108,440,411 (GRCm39) probably null Het
Inmt C A 6: 55,150,404 (GRCm39) V78F possibly damaging Het
Kansl1 T C 11: 104,233,283 (GRCm39) H748R possibly damaging Het
Kif28 T C 1: 179,533,319 (GRCm39) K541E possibly damaging Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Kifc2 T C 15: 76,550,281 (GRCm39) V480A probably damaging Het
Lrrc74a T C 12: 86,784,484 (GRCm39) Y71H probably damaging Het
Ly75 T G 2: 60,142,121 (GRCm39) T1330P probably damaging Het
Macf1 A G 4: 123,270,210 (GRCm39) V6647A probably damaging Het
Mgat1 T C 11: 49,152,111 (GRCm39) I198T possibly damaging Het
Morc3 A G 16: 93,652,398 (GRCm39) Y367C probably damaging Het
Mtfr1 A G 3: 19,269,837 (GRCm39) T162A probably damaging Het
Myrip C T 9: 120,217,228 (GRCm39) S49L probably damaging Het
Nup153 A T 13: 46,835,113 (GRCm39) N1397K possibly damaging Het
Or5h26 T C 16: 58,988,243 (GRCm39) K88E probably benign Het
Or6x1 T C 9: 40,098,558 (GRCm39) V49A probably benign Het
Or8b36 T C 9: 37,937,803 (GRCm39) S234P probably damaging Het
Or8g21 T C 9: 38,905,902 (GRCm39) I276M possibly damaging Het
Pabpc2 G T 18: 39,907,163 (GRCm39) V143L probably damaging Het
Pals2 T G 6: 50,140,411 (GRCm39) F144V probably benign Het
Panx3 T C 9: 37,575,322 (GRCm39) K180R probably benign Het
Patj G A 4: 98,511,885 (GRCm39) V144M possibly damaging Het
Pde1c T A 6: 56,103,877 (GRCm39) K651* probably null Het
Pde4c A G 8: 71,179,638 (GRCm39) H63R probably benign Het
Pdha2 T A 3: 140,916,960 (GRCm39) K183* probably null Het
Pkd1l3 T A 8: 110,375,038 (GRCm39) C1504S probably benign Het
Plbd2 A T 5: 120,625,574 (GRCm39) probably null Het
Poteg G A 8: 27,940,195 (GRCm39) W121* probably null Het
Prf1 C A 10: 61,138,762 (GRCm39) T240N probably damaging Het
Ptprf A G 4: 118,067,068 (GRCm39) Y1883H probably damaging Het
Puf60 T C 15: 75,943,323 (GRCm39) T322A possibly damaging Het
Rev3l A G 10: 39,704,420 (GRCm39) I281M probably benign Het
Rufy1 T C 11: 50,305,399 (GRCm39) I305V probably benign Het
Shisa9 A C 16: 12,085,426 (GRCm39) Q329P probably damaging Het
Siglech G A 7: 55,418,332 (GRCm39) R100Q probably damaging Het
Slc13a5 T A 11: 72,144,169 (GRCm39) Y303F probably benign Het
Snx6 C T 12: 54,830,259 (GRCm39) V67I possibly damaging Het
Spef2 C T 15: 9,584,194 (GRCm39) E1624K probably damaging Het
Tecpr2 A G 12: 110,892,888 (GRCm39) Y310C probably damaging Het
Top1 T A 2: 160,557,643 (GRCm39) L575Q probably damaging Het
Usp16 C T 16: 87,276,020 (GRCm39) R452* probably null Het
Utrn A G 10: 12,585,708 (GRCm39) probably null Het
Vps13b G A 15: 35,877,723 (GRCm39) G2899E probably benign Het
Wipi2 T A 5: 142,643,963 (GRCm39) L115Q probably damaging Het
Zbtb7c A C 18: 76,270,596 (GRCm39) E228A probably damaging Het
Zfp26 T C 9: 20,353,487 (GRCm39) T101A probably benign Het
Zfp593 A T 4: 133,972,394 (GRCm39) probably null Het
Zfp646 G A 7: 127,482,292 (GRCm39) G1490S probably benign Het
Zfp948 G A 17: 21,805,069 (GRCm39) V20M probably damaging Het
Zranb3 A T 1: 127,945,293 (GRCm39) probably null Het
Other mutations in Inpp5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Inpp5e APN 2 26,298,533 (GRCm39) missense probably benign
IGL00943:Inpp5e APN 2 26,290,163 (GRCm39) splice site probably benign
IGL01518:Inpp5e APN 2 26,287,946 (GRCm39) missense probably damaging 1.00
R0212:Inpp5e UTSW 2 26,298,352 (GRCm39) splice site probably null
R1876:Inpp5e UTSW 2 26,298,169 (GRCm39) missense possibly damaging 0.91
R2508:Inpp5e UTSW 2 26,289,355 (GRCm39) missense probably damaging 1.00
R4175:Inpp5e UTSW 2 26,290,937 (GRCm39) missense probably damaging 0.99
R4647:Inpp5e UTSW 2 26,297,926 (GRCm39) missense probably benign 0.01
R4668:Inpp5e UTSW 2 26,291,006 (GRCm39) missense probably damaging 0.97
R4895:Inpp5e UTSW 2 26,287,924 (GRCm39) missense probably damaging 1.00
R4908:Inpp5e UTSW 2 26,290,918 (GRCm39) missense probably damaging 1.00
R5090:Inpp5e UTSW 2 26,289,383 (GRCm39) splice site probably null
R5096:Inpp5e UTSW 2 26,289,537 (GRCm39) missense probably damaging 1.00
R5830:Inpp5e UTSW 2 26,290,427 (GRCm39) missense probably damaging 1.00
R6056:Inpp5e UTSW 2 26,297,860 (GRCm39) nonsense probably null
R6899:Inpp5e UTSW 2 26,290,060 (GRCm39) missense possibly damaging 0.77
R6939:Inpp5e UTSW 2 26,297,774 (GRCm39) splice site probably null
R7003:Inpp5e UTSW 2 26,287,877 (GRCm39) missense probably benign 0.01
R7164:Inpp5e UTSW 2 26,297,995 (GRCm39) missense possibly damaging 0.66
R7275:Inpp5e UTSW 2 26,298,104 (GRCm39) missense probably benign 0.00
R7285:Inpp5e UTSW 2 26,287,870 (GRCm39) missense probably benign 0.36
R7468:Inpp5e UTSW 2 26,298,161 (GRCm39) missense probably benign 0.00
R7873:Inpp5e UTSW 2 26,297,957 (GRCm39) nonsense probably null
R8032:Inpp5e UTSW 2 26,286,865 (GRCm39) missense
R8146:Inpp5e UTSW 2 26,289,274 (GRCm39) missense probably benign 0.00
R9227:Inpp5e UTSW 2 26,288,616 (GRCm39) missense probably damaging 1.00
R9310:Inpp5e UTSW 2 26,287,940 (GRCm39) missense probably benign
R9706:Inpp5e UTSW 2 26,292,126 (GRCm39) missense probably benign 0.21
RF002:Inpp5e UTSW 2 26,298,389 (GRCm39) missense possibly damaging 0.95
X0061:Inpp5e UTSW 2 26,292,159 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAATGTCCTGAGGGCTGGGTC -3'
(R):5'- AGCTGAGTGAAGTTGAGGCC -3'

Sequencing Primer
(F):5'- TCTGTGGTGAGAGCAGGGAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2014-06-23