Incidental Mutation 'R1818:Ly75'
ID 204568
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission 039846-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1818 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 60122447-60213617 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 60142121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 1330 (T1330P)
Ref Sequence ENSEMBL: ENSMUSP00000108152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: T1330P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: T1330P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: T1330P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: T1330P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,857 (GRCm39) probably null Het
Adam6b T A 12: 113,454,876 (GRCm39) N564K probably benign Het
Ahi1 A G 10: 20,864,461 (GRCm39) Y731C probably damaging Het
Ankk1 A G 9: 49,331,725 (GRCm39) Y190H probably benign Het
Ankmy1 T A 1: 92,814,553 (GRCm39) D318V probably benign Het
Ankrd33b G A 15: 31,367,267 (GRCm39) A91V probably damaging Het
Ap3b1 A G 13: 94,608,212 (GRCm39) N561S possibly damaging Het
Apob A G 12: 8,056,834 (GRCm39) N1739S probably damaging Het
Apob A G 12: 8,063,064 (GRCm39) T236A possibly damaging Het
Birc6 G A 17: 74,956,844 (GRCm39) A3593T probably damaging Het
Bnc2 A G 4: 84,210,111 (GRCm39) F778L possibly damaging Het
Capn2 T A 1: 182,300,162 (GRCm39) K609N probably benign Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Card11 A T 5: 140,871,315 (GRCm39) D729E probably benign Het
Ccl20 A G 1: 83,095,529 (GRCm39) Y30C probably damaging Het
Cd209a G A 8: 3,795,576 (GRCm39) T106I probably damaging Het
Cebpz A G 17: 79,242,805 (GRCm39) L283P probably damaging Het
Cecr2 A G 6: 120,708,228 (GRCm39) T77A probably damaging Het
Clec4e T A 6: 123,262,452 (GRCm39) D155V possibly damaging Het
Col25a1 G A 3: 130,379,386 (GRCm39) probably null Het
Cyp2j11 A T 4: 96,185,976 (GRCm39) V403D probably damaging Het
Cyp4v3 G A 8: 45,768,673 (GRCm39) R296C possibly damaging Het
Ddx59 A G 1: 136,360,245 (GRCm39) I420V probably damaging Het
Denr T A 5: 124,055,283 (GRCm39) D49E probably benign Het
Dnaaf3 A T 7: 4,526,568 (GRCm39) probably null Het
Dnaaf3 G T 7: 4,526,569 (GRCm39) L503M probably benign Het
Dnah7a A C 1: 53,598,307 (GRCm39) D1409E probably benign Het
Dnai4 A G 4: 102,929,854 (GRCm39) V56A possibly damaging Het
Efcab3 T A 11: 104,612,333 (GRCm39) L652Q probably benign Het
Ehd4 C T 2: 119,932,885 (GRCm39) W180* probably null Het
Ephb2 A G 4: 136,382,647 (GRCm39) S984P probably benign Het
Eva1a T C 6: 82,048,125 (GRCm39) M1T probably null Het
Fam90a1a C G 8: 22,453,787 (GRCm39) P381A possibly damaging Het
Fam90a1a C A 8: 22,453,788 (GRCm39) P381Q probably damaging Het
Flnc T C 6: 29,457,447 (GRCm39) Y2382H probably damaging Het
Flrt1 A T 19: 7,072,711 (GRCm39) L612Q probably damaging Het
Fubp1 T A 3: 151,927,806 (GRCm39) N419K probably damaging Het
Gin1 A G 1: 97,712,951 (GRCm39) probably null Het
Gm4847 T A 1: 166,465,788 (GRCm39) H267L probably damaging Het
Golga4 T G 9: 118,402,055 (GRCm39) V91G probably damaging Het
Hip1r T C 5: 124,134,018 (GRCm39) probably null Het
Ice2 A G 9: 69,339,383 (GRCm39) S967G probably benign Het
Il18rap A G 1: 40,570,687 (GRCm39) I210V probably benign Het
Impdh2 T G 9: 108,440,411 (GRCm39) probably null Het
Inmt C A 6: 55,150,404 (GRCm39) V78F possibly damaging Het
Inpp5e T C 2: 26,287,886 (GRCm39) S637G probably benign Het
Kansl1 T C 11: 104,233,283 (GRCm39) H748R possibly damaging Het
Kif28 T C 1: 179,533,319 (GRCm39) K541E possibly damaging Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Kifc2 T C 15: 76,550,281 (GRCm39) V480A probably damaging Het
Lrrc74a T C 12: 86,784,484 (GRCm39) Y71H probably damaging Het
Macf1 A G 4: 123,270,210 (GRCm39) V6647A probably damaging Het
Mgat1 T C 11: 49,152,111 (GRCm39) I198T possibly damaging Het
Morc3 A G 16: 93,652,398 (GRCm39) Y367C probably damaging Het
Mtfr1 A G 3: 19,269,837 (GRCm39) T162A probably damaging Het
Myrip C T 9: 120,217,228 (GRCm39) S49L probably damaging Het
Nup153 A T 13: 46,835,113 (GRCm39) N1397K possibly damaging Het
Or5h26 T C 16: 58,988,243 (GRCm39) K88E probably benign Het
Or6x1 T C 9: 40,098,558 (GRCm39) V49A probably benign Het
Or8b36 T C 9: 37,937,803 (GRCm39) S234P probably damaging Het
Or8g21 T C 9: 38,905,902 (GRCm39) I276M possibly damaging Het
Pabpc2 G T 18: 39,907,163 (GRCm39) V143L probably damaging Het
Pals2 T G 6: 50,140,411 (GRCm39) F144V probably benign Het
Panx3 T C 9: 37,575,322 (GRCm39) K180R probably benign Het
Patj G A 4: 98,511,885 (GRCm39) V144M possibly damaging Het
Pde1c T A 6: 56,103,877 (GRCm39) K651* probably null Het
Pde4c A G 8: 71,179,638 (GRCm39) H63R probably benign Het
Pdha2 T A 3: 140,916,960 (GRCm39) K183* probably null Het
Pkd1l3 T A 8: 110,375,038 (GRCm39) C1504S probably benign Het
Plbd2 A T 5: 120,625,574 (GRCm39) probably null Het
Poteg G A 8: 27,940,195 (GRCm39) W121* probably null Het
Prf1 C A 10: 61,138,762 (GRCm39) T240N probably damaging Het
Ptprf A G 4: 118,067,068 (GRCm39) Y1883H probably damaging Het
Puf60 T C 15: 75,943,323 (GRCm39) T322A possibly damaging Het
Rev3l A G 10: 39,704,420 (GRCm39) I281M probably benign Het
Rufy1 T C 11: 50,305,399 (GRCm39) I305V probably benign Het
Shisa9 A C 16: 12,085,426 (GRCm39) Q329P probably damaging Het
Siglech G A 7: 55,418,332 (GRCm39) R100Q probably damaging Het
Slc13a5 T A 11: 72,144,169 (GRCm39) Y303F probably benign Het
Snx6 C T 12: 54,830,259 (GRCm39) V67I possibly damaging Het
Spef2 C T 15: 9,584,194 (GRCm39) E1624K probably damaging Het
Tecpr2 A G 12: 110,892,888 (GRCm39) Y310C probably damaging Het
Top1 T A 2: 160,557,643 (GRCm39) L575Q probably damaging Het
Usp16 C T 16: 87,276,020 (GRCm39) R452* probably null Het
Utrn A G 10: 12,585,708 (GRCm39) probably null Het
Vps13b G A 15: 35,877,723 (GRCm39) G2899E probably benign Het
Wipi2 T A 5: 142,643,963 (GRCm39) L115Q probably damaging Het
Zbtb7c A C 18: 76,270,596 (GRCm39) E228A probably damaging Het
Zfp26 T C 9: 20,353,487 (GRCm39) T101A probably benign Het
Zfp593 A T 4: 133,972,394 (GRCm39) probably null Het
Zfp646 G A 7: 127,482,292 (GRCm39) G1490S probably benign Het
Zfp948 G A 17: 21,805,069 (GRCm39) V20M probably damaging Het
Zranb3 A T 1: 127,945,293 (GRCm39) probably null Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60,206,421 (GRCm39) missense probably damaging 1.00
IGL01072:Ly75 APN 2 60,184,840 (GRCm39) missense probably damaging 1.00
IGL01409:Ly75 APN 2 60,152,036 (GRCm39) splice site probably null
IGL01432:Ly75 APN 2 60,206,351 (GRCm39) missense probably damaging 1.00
IGL01626:Ly75 APN 2 60,131,359 (GRCm39) missense probably benign 0.13
IGL01690:Ly75 APN 2 60,168,655 (GRCm39) missense probably damaging 1.00
IGL01862:Ly75 APN 2 60,129,516 (GRCm39) missense probably damaging 1.00
IGL01982:Ly75 APN 2 60,142,108 (GRCm39) missense probably damaging 1.00
IGL02075:Ly75 APN 2 60,182,700 (GRCm39) missense probably damaging 0.99
IGL02338:Ly75 APN 2 60,184,796 (GRCm39) missense probably benign 0.04
IGL02364:Ly75 APN 2 60,188,851 (GRCm39) missense probably damaging 1.00
IGL02456:Ly75 APN 2 60,124,125 (GRCm39) missense probably benign 0.09
IGL02474:Ly75 APN 2 60,213,526 (GRCm39) missense probably null 1.00
IGL02608:Ly75 APN 2 60,152,244 (GRCm39) missense probably benign 0.41
IGL02986:Ly75 APN 2 60,138,535 (GRCm39) missense probably damaging 1.00
IGL03015:Ly75 APN 2 60,206,504 (GRCm39) missense probably damaging 1.00
IGL03049:Ly75 APN 2 60,182,414 (GRCm39) missense probably damaging 0.99
euphues UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
four_score UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
lyly UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
Witty UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
D605:Ly75 UTSW 2 60,182,696 (GRCm39) critical splice donor site probably null
R0046:Ly75 UTSW 2 60,169,801 (GRCm39) intron probably benign
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0285:Ly75 UTSW 2 60,148,663 (GRCm39) missense probably damaging 1.00
R0387:Ly75 UTSW 2 60,136,748 (GRCm39) missense probably benign 0.20
R0492:Ly75 UTSW 2 60,138,620 (GRCm39) missense probably damaging 1.00
R0688:Ly75 UTSW 2 60,146,565 (GRCm39) missense probably benign 0.41
R1367:Ly75 UTSW 2 60,124,102 (GRCm39) splice site probably null
R1463:Ly75 UTSW 2 60,199,101 (GRCm39) critical splice donor site probably null
R1581:Ly75 UTSW 2 60,158,237 (GRCm39) missense probably damaging 1.00
R1663:Ly75 UTSW 2 60,144,578 (GRCm39) missense probably damaging 1.00
R1881:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R2244:Ly75 UTSW 2 60,180,257 (GRCm39) missense probably benign 0.01
R2905:Ly75 UTSW 2 60,164,898 (GRCm39) missense probably benign 0.00
R3967:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60,183,339 (GRCm39) missense probably damaging 1.00
R4406:Ly75 UTSW 2 60,184,894 (GRCm39) missense probably damaging 1.00
R4526:Ly75 UTSW 2 60,161,117 (GRCm39) missense probably benign 0.09
R4647:Ly75 UTSW 2 60,138,622 (GRCm39) missense probably damaging 1.00
R4795:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4796:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4962:Ly75 UTSW 2 60,182,469 (GRCm39) missense probably damaging 1.00
R4979:Ly75 UTSW 2 60,206,238 (GRCm39) missense probably damaging 1.00
R5072:Ly75 UTSW 2 60,206,307 (GRCm39) missense probably damaging 1.00
R5288:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5373:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60,164,831 (GRCm39) nonsense probably null
R5385:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5395:Ly75 UTSW 2 60,195,455 (GRCm39) missense probably benign 0.41
R5531:Ly75 UTSW 2 60,195,489 (GRCm39) missense probably damaging 0.98
R5662:Ly75 UTSW 2 60,182,725 (GRCm39) missense probably damaging 1.00
R5667:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5668:Ly75 UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
R5671:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5677:Ly75 UTSW 2 60,129,426 (GRCm39) missense probably benign 0.00
R5764:Ly75 UTSW 2 60,148,783 (GRCm39) missense probably benign
R5896:Ly75 UTSW 2 60,213,490 (GRCm39) missense probably benign
R6025:Ly75 UTSW 2 60,206,306 (GRCm39) missense probably damaging 1.00
R6113:Ly75 UTSW 2 60,199,217 (GRCm39) missense probably benign 0.04
R6448:Ly75 UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
R6601:Ly75 UTSW 2 60,148,720 (GRCm39) missense probably benign 0.11
R6745:Ly75 UTSW 2 60,138,523 (GRCm39) missense probably damaging 1.00
R6955:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60,136,749 (GRCm39) missense probably benign
R7100:Ly75 UTSW 2 60,136,778 (GRCm39) missense probably benign
R7110:Ly75 UTSW 2 60,206,528 (GRCm39) missense probably benign 0.31
R7203:Ly75 UTSW 2 60,154,196 (GRCm39) nonsense probably null
R7291:Ly75 UTSW 2 60,160,337 (GRCm39) missense probably damaging 0.98
R7308:Ly75 UTSW 2 60,164,859 (GRCm39) missense probably benign 0.04
R7447:Ly75 UTSW 2 60,164,818 (GRCm39) nonsense probably null
R7512:Ly75 UTSW 2 60,164,907 (GRCm39) missense probably damaging 1.00
R7595:Ly75 UTSW 2 60,124,171 (GRCm39) missense probably benign 0.01
R7976:Ly75 UTSW 2 60,195,432 (GRCm39) missense probably damaging 1.00
R8005:Ly75 UTSW 2 60,163,278 (GRCm39) missense probably damaging 1.00
R8171:Ly75 UTSW 2 60,144,572 (GRCm39) missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R8705:Ly75 UTSW 2 60,148,729 (GRCm39) missense probably damaging 0.98
R8714:Ly75 UTSW 2 60,164,829 (GRCm39) missense probably damaging 1.00
R8798:Ly75 UTSW 2 60,154,270 (GRCm39) missense probably benign 0.32
R8799:Ly75 UTSW 2 60,178,785 (GRCm39) missense probably damaging 1.00
R8834:Ly75 UTSW 2 60,161,433 (GRCm39) missense probably benign
R8990:Ly75 UTSW 2 60,188,903 (GRCm39) missense probably benign 0.10
R9015:Ly75 UTSW 2 60,146,442 (GRCm39) missense probably benign
R9547:Ly75 UTSW 2 60,161,069 (GRCm39) critical splice donor site probably null
R9628:Ly75 UTSW 2 60,158,285 (GRCm39) missense probably damaging 1.00
R9659:Ly75 UTSW 2 60,168,665 (GRCm39) missense probably damaging 1.00
R9660:Ly75 UTSW 2 60,154,184 (GRCm39) missense probably damaging 1.00
R9747:Ly75 UTSW 2 60,136,672 (GRCm39) critical splice donor site probably null
X0025:Ly75 UTSW 2 60,184,819 (GRCm39) missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60,182,477 (GRCm39) missense possibly damaging 0.65
Z1177:Ly75 UTSW 2 60,180,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTGACTAAGACTCTTACCC -3'
(R):5'- ACAGGCTACTAAAGAGTGGAATTAC -3'

Sequencing Primer
(F):5'- AGGTGACTAAGACTCTTACCCATTTC -3'
(R):5'- CCTTTTAGATGGTATGGAAAGG -3'
Posted On 2014-06-23