Incidental Mutation 'R1818:Golga4'
ID 204620
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 039846-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1818 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118402055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 91 (V91G)
Ref Sequence ENSEMBL: ENSMUSP00000148276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000211846]
AlphaFold Q91VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000084820
AA Change: V2191G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: V2191G

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211838
Predicted Effect unknown
Transcript: ENSMUST00000211840
AA Change: V1201G
Predicted Effect probably damaging
Transcript: ENSMUST00000211846
AA Change: V91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212151
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212692
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,857 (GRCm39) probably null Het
Adam6b T A 12: 113,454,876 (GRCm39) N564K probably benign Het
Ahi1 A G 10: 20,864,461 (GRCm39) Y731C probably damaging Het
Ankk1 A G 9: 49,331,725 (GRCm39) Y190H probably benign Het
Ankmy1 T A 1: 92,814,553 (GRCm39) D318V probably benign Het
Ankrd33b G A 15: 31,367,267 (GRCm39) A91V probably damaging Het
Ap3b1 A G 13: 94,608,212 (GRCm39) N561S possibly damaging Het
Apob A G 12: 8,056,834 (GRCm39) N1739S probably damaging Het
Apob A G 12: 8,063,064 (GRCm39) T236A possibly damaging Het
Birc6 G A 17: 74,956,844 (GRCm39) A3593T probably damaging Het
Bnc2 A G 4: 84,210,111 (GRCm39) F778L possibly damaging Het
Capn2 T A 1: 182,300,162 (GRCm39) K609N probably benign Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Card11 A T 5: 140,871,315 (GRCm39) D729E probably benign Het
Ccl20 A G 1: 83,095,529 (GRCm39) Y30C probably damaging Het
Cd209a G A 8: 3,795,576 (GRCm39) T106I probably damaging Het
Cebpz A G 17: 79,242,805 (GRCm39) L283P probably damaging Het
Cecr2 A G 6: 120,708,228 (GRCm39) T77A probably damaging Het
Clec4e T A 6: 123,262,452 (GRCm39) D155V possibly damaging Het
Col25a1 G A 3: 130,379,386 (GRCm39) probably null Het
Cyp2j11 A T 4: 96,185,976 (GRCm39) V403D probably damaging Het
Cyp4v3 G A 8: 45,768,673 (GRCm39) R296C possibly damaging Het
Ddx59 A G 1: 136,360,245 (GRCm39) I420V probably damaging Het
Denr T A 5: 124,055,283 (GRCm39) D49E probably benign Het
Dnaaf3 A T 7: 4,526,568 (GRCm39) probably null Het
Dnaaf3 G T 7: 4,526,569 (GRCm39) L503M probably benign Het
Dnah7a A C 1: 53,598,307 (GRCm39) D1409E probably benign Het
Dnai4 A G 4: 102,929,854 (GRCm39) V56A possibly damaging Het
Efcab3 T A 11: 104,612,333 (GRCm39) L652Q probably benign Het
Ehd4 C T 2: 119,932,885 (GRCm39) W180* probably null Het
Ephb2 A G 4: 136,382,647 (GRCm39) S984P probably benign Het
Eva1a T C 6: 82,048,125 (GRCm39) M1T probably null Het
Fam90a1a C G 8: 22,453,787 (GRCm39) P381A possibly damaging Het
Fam90a1a C A 8: 22,453,788 (GRCm39) P381Q probably damaging Het
Flnc T C 6: 29,457,447 (GRCm39) Y2382H probably damaging Het
Flrt1 A T 19: 7,072,711 (GRCm39) L612Q probably damaging Het
Fubp1 T A 3: 151,927,806 (GRCm39) N419K probably damaging Het
Gin1 A G 1: 97,712,951 (GRCm39) probably null Het
Gm4847 T A 1: 166,465,788 (GRCm39) H267L probably damaging Het
Hip1r T C 5: 124,134,018 (GRCm39) probably null Het
Ice2 A G 9: 69,339,383 (GRCm39) S967G probably benign Het
Il18rap A G 1: 40,570,687 (GRCm39) I210V probably benign Het
Impdh2 T G 9: 108,440,411 (GRCm39) probably null Het
Inmt C A 6: 55,150,404 (GRCm39) V78F possibly damaging Het
Inpp5e T C 2: 26,287,886 (GRCm39) S637G probably benign Het
Kansl1 T C 11: 104,233,283 (GRCm39) H748R possibly damaging Het
Kif28 T C 1: 179,533,319 (GRCm39) K541E possibly damaging Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Kifc2 T C 15: 76,550,281 (GRCm39) V480A probably damaging Het
Lrrc74a T C 12: 86,784,484 (GRCm39) Y71H probably damaging Het
Ly75 T G 2: 60,142,121 (GRCm39) T1330P probably damaging Het
Macf1 A G 4: 123,270,210 (GRCm39) V6647A probably damaging Het
Mgat1 T C 11: 49,152,111 (GRCm39) I198T possibly damaging Het
Morc3 A G 16: 93,652,398 (GRCm39) Y367C probably damaging Het
Mtfr1 A G 3: 19,269,837 (GRCm39) T162A probably damaging Het
Myrip C T 9: 120,217,228 (GRCm39) S49L probably damaging Het
Nup153 A T 13: 46,835,113 (GRCm39) N1397K possibly damaging Het
Or5h26 T C 16: 58,988,243 (GRCm39) K88E probably benign Het
Or6x1 T C 9: 40,098,558 (GRCm39) V49A probably benign Het
Or8b36 T C 9: 37,937,803 (GRCm39) S234P probably damaging Het
Or8g21 T C 9: 38,905,902 (GRCm39) I276M possibly damaging Het
Pabpc2 G T 18: 39,907,163 (GRCm39) V143L probably damaging Het
Pals2 T G 6: 50,140,411 (GRCm39) F144V probably benign Het
Panx3 T C 9: 37,575,322 (GRCm39) K180R probably benign Het
Patj G A 4: 98,511,885 (GRCm39) V144M possibly damaging Het
Pde1c T A 6: 56,103,877 (GRCm39) K651* probably null Het
Pde4c A G 8: 71,179,638 (GRCm39) H63R probably benign Het
Pdha2 T A 3: 140,916,960 (GRCm39) K183* probably null Het
Pkd1l3 T A 8: 110,375,038 (GRCm39) C1504S probably benign Het
Plbd2 A T 5: 120,625,574 (GRCm39) probably null Het
Poteg G A 8: 27,940,195 (GRCm39) W121* probably null Het
Prf1 C A 10: 61,138,762 (GRCm39) T240N probably damaging Het
Ptprf A G 4: 118,067,068 (GRCm39) Y1883H probably damaging Het
Puf60 T C 15: 75,943,323 (GRCm39) T322A possibly damaging Het
Rev3l A G 10: 39,704,420 (GRCm39) I281M probably benign Het
Rufy1 T C 11: 50,305,399 (GRCm39) I305V probably benign Het
Shisa9 A C 16: 12,085,426 (GRCm39) Q329P probably damaging Het
Siglech G A 7: 55,418,332 (GRCm39) R100Q probably damaging Het
Slc13a5 T A 11: 72,144,169 (GRCm39) Y303F probably benign Het
Snx6 C T 12: 54,830,259 (GRCm39) V67I possibly damaging Het
Spef2 C T 15: 9,584,194 (GRCm39) E1624K probably damaging Het
Tecpr2 A G 12: 110,892,888 (GRCm39) Y310C probably damaging Het
Top1 T A 2: 160,557,643 (GRCm39) L575Q probably damaging Het
Usp16 C T 16: 87,276,020 (GRCm39) R452* probably null Het
Utrn A G 10: 12,585,708 (GRCm39) probably null Het
Vps13b G A 15: 35,877,723 (GRCm39) G2899E probably benign Het
Wipi2 T A 5: 142,643,963 (GRCm39) L115Q probably damaging Het
Zbtb7c A C 18: 76,270,596 (GRCm39) E228A probably damaging Het
Zfp26 T C 9: 20,353,487 (GRCm39) T101A probably benign Het
Zfp593 A T 4: 133,972,394 (GRCm39) probably null Het
Zfp646 G A 7: 127,482,292 (GRCm39) G1490S probably benign Het
Zfp948 G A 17: 21,805,069 (GRCm39) V20M probably damaging Het
Zranb3 A T 1: 127,945,293 (GRCm39) probably null Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TAGTGTGAGCATGTGCACAGC -3'
(R):5'- CTATCTGCAGGGCCCTAAAACC -3'

Sequencing Primer
(F):5'- CAGCTAATGGGGCACAAGC -3'
(R):5'- GGGCCCTAAAACCTCCTTAAAATAC -3'
Posted On 2014-06-23