Incidental Mutation 'R1818:Utrn'
ID 204622
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Name utrophin
Synonyms G-utrophin, DRP, Dmdl
MMRRC Submission 039846-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1818 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 12382188-12869365 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12709964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000076817
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218635
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,858 probably null Het
Adam6b T A 12: 113,491,256 N564K probably benign Het
Ahi1 A G 10: 20,988,562 Y731C probably damaging Het
Ankk1 A G 9: 49,420,425 Y190H probably benign Het
Ankmy1 T A 1: 92,886,831 D318V probably benign Het
Ankrd33b G A 15: 31,367,121 A91V probably damaging Het
Ap3b1 A G 13: 94,471,704 N561S possibly damaging Het
Apob A G 12: 8,013,064 T236A possibly damaging Het
Apob A G 12: 8,006,834 N1739S probably damaging Het
Birc6 G A 17: 74,649,849 A3593T probably damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccl20 A G 1: 83,117,808 Y30C probably damaging Het
Cd209a G A 8: 3,745,576 T106I probably damaging Het
Cebpz A G 17: 78,935,376 L283P probably damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Clec4e T A 6: 123,285,493 D155V possibly damaging Het
Col25a1 G A 3: 130,585,737 probably null Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Denr T A 5: 123,917,220 D49E probably benign Het
Dnaaf3 G T 7: 4,523,570 L503M probably benign Het
Dnaaf3 A T 7: 4,523,569 probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Ehd4 C T 2: 120,102,404 W180* probably null Het
Ephb2 A G 4: 136,655,336 S984P probably benign Het
Eva1a T C 6: 82,071,144 M1T probably null Het
Fam90a1a C G 8: 21,963,771 P381A possibly damaging Het
Fam90a1a C A 8: 21,963,772 P381Q probably damaging Het
Flnc T C 6: 29,457,448 Y2382H probably damaging Het
Flrt1 A T 19: 7,095,346 L612Q probably damaging Het
Fubp1 T A 3: 152,222,169 N419K probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm11639 T A 11: 104,721,507 L652Q probably benign Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Golga4 T G 9: 118,572,987 V91G probably damaging Het
Hip1r T C 5: 123,995,955 probably null Het
Ice2 A G 9: 69,432,101 S967G probably benign Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Impdh2 T G 9: 108,563,212 probably null Het
Inmt C A 6: 55,173,419 V78F possibly damaging Het
Inpp5e T C 2: 26,397,874 S637G probably benign Het
Kansl1 T C 11: 104,342,457 H748R possibly damaging Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Kifc2 T C 15: 76,666,081 V480A probably damaging Het
Lrrc74a T C 12: 86,737,710 Y71H probably damaging Het
Ly75 T G 2: 60,311,777 T1330P probably damaging Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mgat1 T C 11: 49,261,284 I198T possibly damaging Het
Morc3 A G 16: 93,855,510 Y367C probably damaging Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Mtfr1 A G 3: 19,215,673 T162A probably damaging Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nup153 A T 13: 46,681,637 N1397K possibly damaging Het
Olfr196 T C 16: 59,167,880 K88E probably benign Het
Olfr883 T C 9: 38,026,507 S234P probably damaging Het
Olfr935 T C 9: 38,994,606 I276M possibly damaging Het
Olfr986 T C 9: 40,187,262 V49A probably benign Het
Pabpc2 G T 18: 39,774,110 V143L probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Patj G A 4: 98,623,648 V144M possibly damaging Het
Pde1c T A 6: 56,126,892 K651* probably null Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdha2 T A 3: 141,211,199 K183* probably null Het
Pkd1l3 T A 8: 109,648,406 C1504S probably benign Het
Plbd2 A T 5: 120,487,509 probably null Het
Poteg G A 8: 27,450,167 W121* probably null Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Ptprf A G 4: 118,209,871 Y1883H probably damaging Het
Puf60 T C 15: 76,071,474 T322A possibly damaging Het
Rev3l A G 10: 39,828,424 I281M probably benign Het
Rufy1 T C 11: 50,414,572 I305V probably benign Het
Shisa9 A C 16: 12,267,562 Q329P probably damaging Het
Siglech G A 7: 55,768,584 R100Q probably damaging Het
Slc13a5 T A 11: 72,253,343 Y303F probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Tecpr2 A G 12: 110,926,454 Y310C probably damaging Het
Top1 T A 2: 160,715,723 L575Q probably damaging Het
Usp16 C T 16: 87,479,132 R452* probably null Het
Vps13b G A 15: 35,877,577 G2899E probably benign Het
Wdr78 A G 4: 103,072,657 V56A possibly damaging Het
Wipi2 T A 5: 142,658,208 L115Q probably damaging Het
Zbtb7c A C 18: 76,137,525 E228A probably damaging Het
Zfp26 T C 9: 20,442,191 T101A probably benign Het
Zfp593 A T 4: 134,245,083 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp948 G A 17: 21,584,807 V20M probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
retiring UTSW 10 12641020 missense probably damaging 1.00
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7038:Utrn UTSW 10 12682338 missense probably damaging 1.00
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
R7334:Utrn UTSW 10 12728009 splice site probably null
R7348:Utrn UTSW 10 12748018 missense probably damaging 1.00
R7375:Utrn UTSW 10 12641020 missense probably damaging 1.00
R7436:Utrn UTSW 10 12439791 missense possibly damaging 0.72
R7476:Utrn UTSW 10 12640951 missense probably benign
R7514:Utrn UTSW 10 12698089 missense probably benign 0.00
R7527:Utrn UTSW 10 12401382 missense possibly damaging 0.81
R7735:Utrn UTSW 10 12744043 critical splice donor site probably null
R7748:Utrn UTSW 10 12614508 missense probably benign 0.01
R7778:Utrn UTSW 10 12486610 missense probably damaging 1.00
R7824:Utrn UTSW 10 12486610 missense probably damaging 1.00
R7826:Utrn UTSW 10 12401306 splice site probably null
R7872:Utrn UTSW 10 12698129 missense probably benign
R7915:Utrn UTSW 10 12465212 missense probably damaging 1.00
R7922:Utrn UTSW 10 12667527 missense possibly damaging 0.68
R8081:Utrn UTSW 10 12548059 start gained probably benign
R8132:Utrn UTSW 10 12682410 missense probably damaging 0.99
R8167:Utrn UTSW 10 12671814 nonsense probably null
R8186:Utrn UTSW 10 12698123 missense probably benign
R8331:Utrn UTSW 10 12614619 missense probably benign 0.00
R8352:Utrn UTSW 10 12813509 missense probably benign 0.34
R8408:Utrn UTSW 10 12670143 missense possibly damaging 0.69
R8452:Utrn UTSW 10 12813509 missense probably benign 0.34
R8478:Utrn UTSW 10 12649148 missense probably benign
R8489:Utrn UTSW 10 12711446 missense probably benign 0.05
R8516:Utrn UTSW 10 12486510 missense probably damaging 0.99
R8520:Utrn UTSW 10 12670186 nonsense probably null
R8550:Utrn UTSW 10 12813585 intron probably benign
R8856:Utrn UTSW 10 12667607 missense probably benign
R8881:Utrn UTSW 10 12547993 missense possibly damaging 0.46
R9180:Utrn UTSW 10 12669719 missense probably damaging 1.00
R9186:Utrn UTSW 10 12614574 missense probably benign
R9216:Utrn UTSW 10 12813485 missense probably benign 0.19
R9251:Utrn UTSW 10 12636787 missense probably benign 0.01
R9273:Utrn UTSW 10 12633963 missense probably damaging 0.97
R9307:Utrn UTSW 10 12678731 missense probably benign 0.02
R9344:Utrn UTSW 10 12684531 missense probably benign 0.17
R9419:Utrn UTSW 10 12688381 missense probably damaging 1.00
R9435:Utrn UTSW 10 12643429 missense probably damaging 1.00
R9623:Utrn UTSW 10 12406481 missense probably damaging 1.00
R9650:Utrn UTSW 10 12738185 missense probably benign 0.00
R9653:Utrn UTSW 10 12621379 missense probably benign 0.17
R9653:Utrn UTSW 10 12663445 missense probably benign 0.41
R9672:Utrn UTSW 10 12727869 missense possibly damaging 0.68
R9678:Utrn UTSW 10 12739415 missense probably benign 0.00
R9741:Utrn UTSW 10 12826820 missense probably benign
R9765:Utrn UTSW 10 12735177 missense probably damaging 0.99
R9799:Utrn UTSW 10 12709992 missense probably benign 0.01
RF009:Utrn UTSW 10 12633945 nonsense probably null
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Z1176:Utrn UTSW 10 12682360 nonsense probably null
Z1176:Utrn UTSW 10 12688429 critical splice acceptor site probably null
Z1177:Utrn UTSW 10 12525406 nonsense probably null
Z1177:Utrn UTSW 10 12621379 missense probably benign 0.17
Z1186:Utrn UTSW 10 12669747 missense probably damaging 1.00
Z1189:Utrn UTSW 10 12669747 missense probably damaging 1.00
Z1191:Utrn UTSW 10 12669747 missense probably damaging 1.00
Z1192:Utrn UTSW 10 12669747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCCAGCACATTAAAATATCTC -3'
(R):5'- TCGTAGGCCCTTGATGAAAC -3'

Sequencing Primer
(F):5'- TCTCTGATAAGCAAATTATGAATCCC -3'
(R):5'- TAGGCCCTTGATGAAACCCTTGAG -3'
Posted On 2014-06-23