Incidental Mutation 'R1818:Kansl1'
ID 204630
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene Name KAT8 regulatory NSL complex subunit 1
Synonyms 1700081L11Rik
MMRRC Submission 039846-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1818 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 104224055-104359687 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104233283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 748 (H748R)
Ref Sequence ENSEMBL: ENSMUSP00000102590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]
AlphaFold Q80TG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000018556
AA Change: H748R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: H748R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069188
Predicted Effect possibly damaging
Transcript: ENSMUST00000106971
AA Change: H811R

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: H811R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106972
AA Change: H811R

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: H811R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106977
AA Change: H748R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: H748R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,857 (GRCm39) probably null Het
Adam6b T A 12: 113,454,876 (GRCm39) N564K probably benign Het
Ahi1 A G 10: 20,864,461 (GRCm39) Y731C probably damaging Het
Ankk1 A G 9: 49,331,725 (GRCm39) Y190H probably benign Het
Ankmy1 T A 1: 92,814,553 (GRCm39) D318V probably benign Het
Ankrd33b G A 15: 31,367,267 (GRCm39) A91V probably damaging Het
Ap3b1 A G 13: 94,608,212 (GRCm39) N561S possibly damaging Het
Apob A G 12: 8,056,834 (GRCm39) N1739S probably damaging Het
Apob A G 12: 8,063,064 (GRCm39) T236A possibly damaging Het
Birc6 G A 17: 74,956,844 (GRCm39) A3593T probably damaging Het
Bnc2 A G 4: 84,210,111 (GRCm39) F778L possibly damaging Het
Capn2 T A 1: 182,300,162 (GRCm39) K609N probably benign Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Card11 A T 5: 140,871,315 (GRCm39) D729E probably benign Het
Ccl20 A G 1: 83,095,529 (GRCm39) Y30C probably damaging Het
Cd209a G A 8: 3,795,576 (GRCm39) T106I probably damaging Het
Cebpz A G 17: 79,242,805 (GRCm39) L283P probably damaging Het
Cecr2 A G 6: 120,708,228 (GRCm39) T77A probably damaging Het
Clec4e T A 6: 123,262,452 (GRCm39) D155V possibly damaging Het
Col25a1 G A 3: 130,379,386 (GRCm39) probably null Het
Cyp2j11 A T 4: 96,185,976 (GRCm39) V403D probably damaging Het
Cyp4v3 G A 8: 45,768,673 (GRCm39) R296C possibly damaging Het
Ddx59 A G 1: 136,360,245 (GRCm39) I420V probably damaging Het
Denr T A 5: 124,055,283 (GRCm39) D49E probably benign Het
Dnaaf3 A T 7: 4,526,568 (GRCm39) probably null Het
Dnaaf3 G T 7: 4,526,569 (GRCm39) L503M probably benign Het
Dnah7a A C 1: 53,598,307 (GRCm39) D1409E probably benign Het
Dnai4 A G 4: 102,929,854 (GRCm39) V56A possibly damaging Het
Efcab3 T A 11: 104,612,333 (GRCm39) L652Q probably benign Het
Ehd4 C T 2: 119,932,885 (GRCm39) W180* probably null Het
Ephb2 A G 4: 136,382,647 (GRCm39) S984P probably benign Het
Eva1a T C 6: 82,048,125 (GRCm39) M1T probably null Het
Fam90a1a C G 8: 22,453,787 (GRCm39) P381A possibly damaging Het
Fam90a1a C A 8: 22,453,788 (GRCm39) P381Q probably damaging Het
Flnc T C 6: 29,457,447 (GRCm39) Y2382H probably damaging Het
Flrt1 A T 19: 7,072,711 (GRCm39) L612Q probably damaging Het
Fubp1 T A 3: 151,927,806 (GRCm39) N419K probably damaging Het
Gin1 A G 1: 97,712,951 (GRCm39) probably null Het
Gm4847 T A 1: 166,465,788 (GRCm39) H267L probably damaging Het
Golga4 T G 9: 118,402,055 (GRCm39) V91G probably damaging Het
Hip1r T C 5: 124,134,018 (GRCm39) probably null Het
Ice2 A G 9: 69,339,383 (GRCm39) S967G probably benign Het
Il18rap A G 1: 40,570,687 (GRCm39) I210V probably benign Het
Impdh2 T G 9: 108,440,411 (GRCm39) probably null Het
Inmt C A 6: 55,150,404 (GRCm39) V78F possibly damaging Het
Inpp5e T C 2: 26,287,886 (GRCm39) S637G probably benign Het
Kif28 T C 1: 179,533,319 (GRCm39) K541E possibly damaging Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Kifc2 T C 15: 76,550,281 (GRCm39) V480A probably damaging Het
Lrrc74a T C 12: 86,784,484 (GRCm39) Y71H probably damaging Het
Ly75 T G 2: 60,142,121 (GRCm39) T1330P probably damaging Het
Macf1 A G 4: 123,270,210 (GRCm39) V6647A probably damaging Het
Mgat1 T C 11: 49,152,111 (GRCm39) I198T possibly damaging Het
Morc3 A G 16: 93,652,398 (GRCm39) Y367C probably damaging Het
Mtfr1 A G 3: 19,269,837 (GRCm39) T162A probably damaging Het
Myrip C T 9: 120,217,228 (GRCm39) S49L probably damaging Het
Nup153 A T 13: 46,835,113 (GRCm39) N1397K possibly damaging Het
Or5h26 T C 16: 58,988,243 (GRCm39) K88E probably benign Het
Or6x1 T C 9: 40,098,558 (GRCm39) V49A probably benign Het
Or8b36 T C 9: 37,937,803 (GRCm39) S234P probably damaging Het
Or8g21 T C 9: 38,905,902 (GRCm39) I276M possibly damaging Het
Pabpc2 G T 18: 39,907,163 (GRCm39) V143L probably damaging Het
Pals2 T G 6: 50,140,411 (GRCm39) F144V probably benign Het
Panx3 T C 9: 37,575,322 (GRCm39) K180R probably benign Het
Patj G A 4: 98,511,885 (GRCm39) V144M possibly damaging Het
Pde1c T A 6: 56,103,877 (GRCm39) K651* probably null Het
Pde4c A G 8: 71,179,638 (GRCm39) H63R probably benign Het
Pdha2 T A 3: 140,916,960 (GRCm39) K183* probably null Het
Pkd1l3 T A 8: 110,375,038 (GRCm39) C1504S probably benign Het
Plbd2 A T 5: 120,625,574 (GRCm39) probably null Het
Poteg G A 8: 27,940,195 (GRCm39) W121* probably null Het
Prf1 C A 10: 61,138,762 (GRCm39) T240N probably damaging Het
Ptprf A G 4: 118,067,068 (GRCm39) Y1883H probably damaging Het
Puf60 T C 15: 75,943,323 (GRCm39) T322A possibly damaging Het
Rev3l A G 10: 39,704,420 (GRCm39) I281M probably benign Het
Rufy1 T C 11: 50,305,399 (GRCm39) I305V probably benign Het
Shisa9 A C 16: 12,085,426 (GRCm39) Q329P probably damaging Het
Siglech G A 7: 55,418,332 (GRCm39) R100Q probably damaging Het
Slc13a5 T A 11: 72,144,169 (GRCm39) Y303F probably benign Het
Snx6 C T 12: 54,830,259 (GRCm39) V67I possibly damaging Het
Spef2 C T 15: 9,584,194 (GRCm39) E1624K probably damaging Het
Tecpr2 A G 12: 110,892,888 (GRCm39) Y310C probably damaging Het
Top1 T A 2: 160,557,643 (GRCm39) L575Q probably damaging Het
Usp16 C T 16: 87,276,020 (GRCm39) R452* probably null Het
Utrn A G 10: 12,585,708 (GRCm39) probably null Het
Vps13b G A 15: 35,877,723 (GRCm39) G2899E probably benign Het
Wipi2 T A 5: 142,643,963 (GRCm39) L115Q probably damaging Het
Zbtb7c A C 18: 76,270,596 (GRCm39) E228A probably damaging Het
Zfp26 T C 9: 20,353,487 (GRCm39) T101A probably benign Het
Zfp593 A T 4: 133,972,394 (GRCm39) probably null Het
Zfp646 G A 7: 127,482,292 (GRCm39) G1490S probably benign Het
Zfp948 G A 17: 21,805,069 (GRCm39) V20M probably damaging Het
Zranb3 A T 1: 127,945,293 (GRCm39) probably null Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104,315,292 (GRCm39) missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104,248,352 (GRCm39) missense probably benign 0.10
IGL00688:Kansl1 APN 11 104,315,892 (GRCm39) missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104,226,422 (GRCm39) missense probably benign 0.01
IGL01624:Kansl1 APN 11 104,315,378 (GRCm39) missense probably benign 0.13
IGL02187:Kansl1 APN 11 104,269,657 (GRCm39) splice site probably null
IGL02711:Kansl1 APN 11 104,226,401 (GRCm39) missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104,225,991 (GRCm39) missense probably damaging 0.99
kansas UTSW 11 104,314,958 (GRCm39) missense possibly damaging 0.94
wichita UTSW 11 104,247,593 (GRCm39) missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104,233,193 (GRCm39) missense probably benign 0.09
R0399:Kansl1 UTSW 11 104,314,958 (GRCm39) missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104,229,012 (GRCm39) missense probably benign 0.31
R0665:Kansl1 UTSW 11 104,234,364 (GRCm39) missense probably benign
R0667:Kansl1 UTSW 11 104,234,364 (GRCm39) missense probably benign
R0747:Kansl1 UTSW 11 104,233,802 (GRCm39) missense probably benign 0.00
R0865:Kansl1 UTSW 11 104,315,194 (GRCm39) missense probably benign 0.08
R1479:Kansl1 UTSW 11 104,233,242 (GRCm39) missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104,314,822 (GRCm39) missense probably damaging 1.00
R1922:Kansl1 UTSW 11 104,234,466 (GRCm39) missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104,225,923 (GRCm39) missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104,226,385 (GRCm39) missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104,315,286 (GRCm39) missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104,234,369 (GRCm39) missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104,234,369 (GRCm39) missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104,269,515 (GRCm39) missense probably benign 0.19
R4455:Kansl1 UTSW 11 104,315,184 (GRCm39) missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104,247,593 (GRCm39) missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104,233,798 (GRCm39) missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104,233,868 (GRCm39) missense probably benign
R4973:Kansl1 UTSW 11 104,315,147 (GRCm39) missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104,226,390 (GRCm39) missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104,315,168 (GRCm39) missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104,247,640 (GRCm39) missense probably benign 0.19
R5310:Kansl1 UTSW 11 104,315,684 (GRCm39) missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104,228,992 (GRCm39) missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104,225,974 (GRCm39) missense probably benign 0.00
R5980:Kansl1 UTSW 11 104,234,463 (GRCm39) missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104,241,465 (GRCm39) missense probably benign 0.00
R6253:Kansl1 UTSW 11 104,248,352 (GRCm39) missense probably benign 0.10
R7751:Kansl1 UTSW 11 104,314,890 (GRCm39) missense probably benign 0.30
R7880:Kansl1 UTSW 11 104,314,979 (GRCm39) missense probably damaging 1.00
R7888:Kansl1 UTSW 11 104,233,248 (GRCm39) missense probably benign 0.00
R7935:Kansl1 UTSW 11 104,315,112 (GRCm39) missense probably damaging 0.99
R8251:Kansl1 UTSW 11 104,315,186 (GRCm39) missense probably benign
R9033:Kansl1 UTSW 11 104,248,356 (GRCm39) missense probably benign 0.00
R9192:Kansl1 UTSW 11 104,227,142 (GRCm39) missense probably damaging 1.00
R9494:Kansl1 UTSW 11 104,247,566 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCATGACTTAGCAGAGATCC -3'
(R):5'- TGCAGGTCACTTCTTACTGC -3'

Sequencing Primer
(F):5'- CAGAGGATCAAGTATCTACATTGGTC -3'
(R):5'- AGGTCACTTCTTACTGCTACAATATC -3'
Posted On 2014-06-23