Mutagenetix > Incidental Mutation

Incidental Mutation 'R1818:Gm11639'

204631

Institutional Source

Beutler Lab

Gene Symbol

Gm11639

Ensembl Gene

ENSMUSG00000040838

Gene Name

predicted gene 11639

Synonyms

MMRRC Submission

039846-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R1818 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104685707-105117394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104721507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 652 (L652Q)

Ref Sequence

ENSEMBL: ENSMUSP00000116040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000148007
AA Change: L652Q

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: L652Q

Domain	Start	End	E-Value	Type
low complexity region	40	55	N/A	INTRINSIC
low complexity region	116	129	N/A	INTRINSIC
internal_repeat_4	146	233	3.42e-6	PROSPERO
internal_repeat_3	165	247	2.21e-6	PROSPERO
low complexity region	331	348	N/A	INTRINSIC
internal_repeat_2	349	361	4.38e-8	PROSPERO
internal_repeat_2	371	383	4.38e-8	PROSPERO
low complexity region	385	640	N/A	INTRINSIC
Pfam:EF-hand_8	677	729	8.7e-6	PFAM
low complexity region	835	842	N/A	INTRINSIC
internal_repeat_1	879	1106	2.47e-14	PROSPERO
internal_repeat_4	1015	1108	3.42e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175713

Predicted Effect

probably benign
Transcript: ENSMUST00000212287

Coding Region Coverage

1x: 97.3%
3x: 96.6%
10x: 94.5%
20x: 90.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,075,858		probably null	Het
Adam6b	T	A	12: 113,491,256	N564K	probably benign	Het
Ahi1	A	G	10: 20,988,562	Y731C	probably damaging	Het
Ankk1	A	G	9: 49,420,425	Y190H	probably benign	Het
Ankmy1	T	A	1: 92,886,831	D318V	probably benign	Het
Ankrd33b	G	A	15: 31,367,121	A91V	probably damaging	Het
Ap3b1	A	G	13: 94,471,704	N561S	possibly damaging	Het
Apob	A	G	12: 8,006,834	N1739S	probably damaging	Het
Apob	A	G	12: 8,013,064	T236A	possibly damaging	Het
Birc6	G	A	17: 74,649,849	A3593T	probably damaging	Het
Bnc2	A	G	4: 84,291,874	F778L	possibly damaging	Het
Capn2	T	A	1: 182,472,597	K609N	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Card11	A	T	5: 140,885,560	D729E	probably benign	Het
Ccl20	A	G	1: 83,117,808	Y30C	probably damaging	Het
Cd209a	G	A	8: 3,745,576	T106I	probably damaging	Het
Cebpz	A	G	17: 78,935,376	L283P	probably damaging	Het
Cecr2	A	G	6: 120,731,267	T77A	probably damaging	Het
Clec4e	T	A	6: 123,285,493	D155V	possibly damaging	Het
Col25a1	G	A	3: 130,585,737		probably null	Het
Cyp2j11	A	T	4: 96,297,739	V403D	probably damaging	Het
Cyp4v3	G	A	8: 45,315,636	R296C	possibly damaging	Het
Ddx59	A	G	1: 136,432,507	I420V	probably damaging	Het
Denr	T	A	5: 123,917,220	D49E	probably benign	Het
Dnaaf3	A	T	7: 4,523,569		probably null	Het
Dnaaf3	G	T	7: 4,523,570	L503M	probably benign	Het
Dnah7a	A	C	1: 53,559,148	D1409E	probably benign	Het
Ehd4	C	T	2: 120,102,404	W180*	probably null	Het
Ephb2	A	G	4: 136,655,336	S984P	probably benign	Het
Eva1a	T	C	6: 82,071,144	M1T	probably null	Het
Fam90a1a	C	G	8: 21,963,771	P381A	possibly damaging	Het
Fam90a1a	C	A	8: 21,963,772	P381Q	probably damaging	Het
Flnc	T	C	6: 29,457,448	Y2382H	probably damaging	Het
Flrt1	A	T	19: 7,095,346	L612Q	probably damaging	Het
Fubp1	T	A	3: 152,222,169	N419K	probably damaging	Het
Gin1	A	G	1: 97,785,226		probably null	Het
Gm4847	T	A	1: 166,638,219	H267L	probably damaging	Het
Golga4	T	G	9: 118,572,987	V91G	probably damaging	Het
Hip1r	T	C	5: 123,995,955		probably null	Het
Ice2	A	G	9: 69,432,101	S967G	probably benign	Het
Il18rap	A	G	1: 40,531,527	I210V	probably benign	Het
Impdh2	T	G	9: 108,563,212		probably null	Het
Inmt	C	A	6: 55,173,419	V78F	possibly damaging	Het
Inpp5e	T	C	2: 26,397,874	S637G	probably benign	Het
Kansl1	T	C	11: 104,342,457	H748R	possibly damaging	Het
Kif28	T	C	1: 179,705,754	K541E	possibly damaging	Het
Kifc1	G	A	17: 33,884,711	R195C	probably benign	Het
Kifc2	T	C	15: 76,666,081	V480A	probably damaging	Het
Lrrc74a	T	C	12: 86,737,710	Y71H	probably damaging	Het
Ly75	T	G	2: 60,311,777	T1330P	probably damaging	Het
Macf1	A	G	4: 123,376,417	V6647A	probably damaging	Het
Mgat1	T	C	11: 49,261,284	I198T	possibly damaging	Het
Morc3	A	G	16: 93,855,510	Y367C	probably damaging	Het
Mpp6	T	G	6: 50,163,431	F144V	probably benign	Het
Mtfr1	A	G	3: 19,215,673	T162A	probably damaging	Het
Myrip	C	T	9: 120,388,162	S49L	probably damaging	Het
Nup153	A	T	13: 46,681,637	N1397K	possibly damaging	Het
Olfr196	T	C	16: 59,167,880	K88E	probably benign	Het
Olfr883	T	C	9: 38,026,507	S234P	probably damaging	Het
Olfr935	T	C	9: 38,994,606	I276M	possibly damaging	Het
Olfr986	T	C	9: 40,187,262	V49A	probably benign	Het
Pabpc2	G	T	18: 39,774,110	V143L	probably damaging	Het
Panx3	T	C	9: 37,664,026	K180R	probably benign	Het
Patj	G	A	4: 98,623,648	V144M	possibly damaging	Het
Pde1c	T	A	6: 56,126,892	K651*	probably null	Het
Pde4c	A	G	8: 70,726,989	H63R	probably benign	Het
Pdha2	T	A	3: 141,211,199	K183*	probably null	Het
Pkd1l3	T	A	8: 109,648,406	C1504S	probably benign	Het
Plbd2	A	T	5: 120,487,509		probably null	Het
Poteg	G	A	8: 27,450,167	W121*	probably null	Het
Prf1	C	A	10: 61,302,983	T240N	probably damaging	Het
Ptprf	A	G	4: 118,209,871	Y1883H	probably damaging	Het
Puf60	T	C	15: 76,071,474	T322A	possibly damaging	Het
Rev3l	A	G	10: 39,828,424	I281M	probably benign	Het
Rufy1	T	C	11: 50,414,572	I305V	probably benign	Het
Shisa9	A	C	16: 12,267,562	Q329P	probably damaging	Het
Siglech	G	A	7: 55,768,584	R100Q	probably damaging	Het
Slc13a5	T	A	11: 72,253,343	Y303F	probably benign	Het
Snx6	C	T	12: 54,783,474	V67I	possibly damaging	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
Tecpr2	A	G	12: 110,926,454	Y310C	probably damaging	Het
Top1	T	A	2: 160,715,723	L575Q	probably damaging	Het
Usp16	C	T	16: 87,479,132	R452*	probably null	Het
Utrn	A	G	10: 12,709,964		probably null	Het
Vps13b	G	A	15: 35,877,577	G2899E	probably benign	Het
Wdr78	A	G	4: 103,072,657	V56A	possibly damaging	Het
Wipi2	T	A	5: 142,658,208	L115Q	probably damaging	Het
Zbtb7c	A	C	18: 76,137,525	E228A	probably damaging	Het
Zfp26	T	C	9: 20,442,191	T101A	probably benign	Het
Zfp593	A	T	4: 134,245,083		probably null	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zfp948	G	A	17: 21,584,807	V20M	probably damaging	Het
Zranb3	A	T	1: 128,017,556		probably null	Het

Other mutations in Gm11639

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Gm11639	APN	11	105100021	missense	probably damaging	1.00
IGL01308:Gm11639	APN	11	104720697	missense	probably benign	0.03
IGL01483:Gm11639	APN	11	104739347	missense	probably benign	0.03
IGL01695:Gm11639	APN	11	104736063	missense	probably damaging	1.00
IGL01860:Gm11639	APN	11	104690921	missense	probably benign	0.16
IGL01981:Gm11639	APN	11	104721432	intron	probably benign
IGL01984:Gm11639	APN	11	104738308	missense	probably benign	0.20
IGL02023:Gm11639	APN	11	104721432	intron	probably benign
IGL02252:Gm11639	APN	11	104753927	missense	possibly damaging	0.68
IGL02886:Gm11639	APN	11	105095874	missense	possibly damaging	0.95
IGL03116:Gm11639	APN	11	104721533	missense	probably benign	0.02
IGL03141:Gm11639	APN	11	105095870	missense	probably damaging	0.99
IGL03242:Gm11639	APN	11	105106404	missense	probably damaging	1.00
IGL03274:Gm11639	APN	11	104721093	missense	probably benign	0.03
IGL03408:Gm11639	APN	11	104710621	missense	probably benign	0.03
R0018:Gm11639	UTSW	11	104721552	critical splice donor site	probably null
R0068:Gm11639	UTSW	11	104720822	missense	probably benign	0.29
R0350:Gm11639	UTSW	11	104690880	missense	probably benign	0.03
R0646:Gm11639	UTSW	11	104720501	missense	probably benign	0.03
R0668:Gm11639	UTSW	11	104720492	missense	probably benign	0.16
R0715:Gm11639	UTSW	11	104720880	missense	possibly damaging	0.90
R0944:Gm11639	UTSW	11	104710730	splice site	probably null
R1330:Gm11639	UTSW	11	104746290	missense	possibly damaging	0.84
R1508:Gm11639	UTSW	11	104710677	missense	probably benign	0.03
R1643:Gm11639	UTSW	11	104698978	missense	probably benign	0.16
R1651:Gm11639	UTSW	11	104720666	missense	probably benign	0.03
R1665:Gm11639	UTSW	11	104721114	missense	probably benign	0.07
R1702:Gm11639	UTSW	11	104691006	missense	probably benign	0.03
R1711:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1779:Gm11639	UTSW	11	104720939	missense	probably benign	0.15
R1813:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1896:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1969:Gm11639	UTSW	11	104746264	missense	probably damaging	1.00
R2139:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R2165:Gm11639	UTSW	11	104751862	missense	possibly damaging	0.93
R2359:Gm11639	UTSW	11	104739280	missense	possibly damaging	0.80
R2394:Gm11639	UTSW	11	104738295	missense	probably benign	0.17
R2406:Gm11639	UTSW	11	104720631	missense	probably benign	0.03
R2570:Gm11639	UTSW	11	104733664	missense	probably damaging	1.00
R3795:Gm11639	UTSW	11	104733675	missense	possibly damaging	0.94
R4352:Gm11639	UTSW	11	104739314	missense	probably null	0.25
R4359:Gm11639	UTSW	11	104733721	splice site	probably null
R4424:Gm11639	UTSW	11	104736114	critical splice donor site	probably null
R4895:Gm11639	UTSW	11	104720286	missense	probably benign	0.16
R4895:Gm11639	UTSW	11	104749670	missense	probably damaging	1.00
R5006:Gm11639	UTSW	11	104729677	splice site	probably null
R5066:Gm11639	UTSW	11	104720664	missense	probably benign	0.03
R5329:Gm11639	UTSW	11	104753806	splice site	probably null
R5405:Gm11639	UTSW	11	104721192	missense	probably benign	0.07
R5814:Gm11639	UTSW	11	104736114	critical splice donor site	probably benign
R5888:Gm11639	UTSW	11	104721401	splice site	probably benign
R5910:Gm11639	UTSW	11	104690934	missense	probably benign	0.01
R5975:Gm11639	UTSW	11	104687549	start gained	probably benign
R6019:Gm11639	UTSW	11	105042902	critical splice donor site	probably null
R6028:Gm11639	UTSW	11	104769655	critical splice donor site	probably null
R6048:Gm11639	UTSW	11	104944433	missense	unknown
R6059:Gm11639	UTSW	11	105036769	missense	probably benign	0.03
R6147:Gm11639	UTSW	11	104967740	missense	unknown
R6176:Gm11639	UTSW	11	104792557	missense	probably benign	0.16
R6181:Gm11639	UTSW	11	104831333	missense	probably benign	0.25
R6196:Gm11639	UTSW	11	104855560	missense	probably benign	0.07
R6245:Gm11639	UTSW	11	104785008	missense	probably benign	0.03
R6262:Gm11639	UTSW	11	104893753	missense	probably benign	0.24
R6263:Gm11639	UTSW	11	104919486	missense	unknown
R6277:Gm11639	UTSW	11	105010322	missense	possibly damaging	0.49
R6338:Gm11639	UTSW	11	104843208	nonsense	probably null
R6355:Gm11639	UTSW	11	105005685	missense	probably benign	0.29
R6356:Gm11639	UTSW	11	104893707	missense	probably benign	0.19
R6365:Gm11639	UTSW	11	104924586	missense	unknown
R6391:Gm11639	UTSW	11	104994317	missense	possibly damaging	0.92
R6556:Gm11639	UTSW	11	105008251	missense	probably null	0.03
R6604:Gm11639	UTSW	11	104698946	nonsense	probably null
R6605:Gm11639	UTSW	11	104999281	splice site	probably null
R6634:Gm11639	UTSW	11	104893783	missense	probably benign	0.17
R6851:Gm11639	UTSW	11	105005695	missense	probably benign	0.03
R6862:Gm11639	UTSW	11	104721458	nonsense	probably null
R6949:Gm11639	UTSW	11	104909070	missense	probably damaging	1.00
R6970:Gm11639	UTSW	11	104776356	missense	probably benign	0.03
R7014:Gm11639	UTSW	11	104693422	missense	probably benign	0.03
R7097:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7122:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7124:Gm11639	UTSW	11	104738274	missense	probably benign	0.17
R7146:Gm11639	UTSW	11	104967752	missense	unknown
R7146:Gm11639	UTSW	11	105022938	missense	probably benign	0.03
R7154:Gm11639	UTSW	11	104699140	splice site	probably null
R7175:Gm11639	UTSW	11	104947411	missense	unknown
R7198:Gm11639	UTSW	11	104751885	missense	probably benign	0.15
R7211:Gm11639	UTSW	11	104710713	missense	probably benign	0.01
R7211:Gm11639	UTSW	11	104724609	critical splice donor site	probably null
R7216:Gm11639	UTSW	11	104880549	missense	possibly damaging	0.49
R7221:Gm11639	UTSW	11	104900606	missense	probably benign	0.36
R7233:Gm11639	UTSW	11	104839843	missense	possibly damaging	0.69
R7236:Gm11639	UTSW	11	104899267	missense	probably benign	0.10
R7262:Gm11639	UTSW	11	104854606	critical splice donor site	probably null
R7289:Gm11639	UTSW	11	105038358	missense	probably benign	0.24
R7323:Gm11639	UTSW	11	105030011	missense	probably benign	0.07
R7378:Gm11639	UTSW	11	104714702	missense	probably benign	0.03
R7388:Gm11639	UTSW	11	104721045	missense	probably damaging	0.97
R7390:Gm11639	UTSW	11	104724585	missense	possibly damaging	0.46
R7411:Gm11639	UTSW	11	104999723	missense	probably benign	0.10
R7468:Gm11639	UTSW	11	104749700	missense	probably benign	0.17
R7497:Gm11639	UTSW	11	104762690	critical splice donor site	probably null
R7620:Gm11639	UTSW	11	104832143	missense	possibly damaging	0.95
R7638:Gm11639	UTSW	11	105036799	missense	probably benign	0.03
R7661:Gm11639	UTSW	11	104726677	missense	probably benign	0.03
R7667:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R7682:Gm11639	UTSW	11	104964348	splice site	probably null
R7708:Gm11639	UTSW	11	104964571	missense	unknown
R7721:Gm11639	UTSW	11	104724540	nonsense	probably null
R7747:Gm11639	UTSW	11	104842603	missense	probably damaging	0.96
R7840:Gm11639	UTSW	11	104733713	missense	probably benign	0.07
R7846:Gm11639	UTSW	11	104714745	critical splice donor site	probably null
R7893:Gm11639	UTSW	11	104979360	missense	unknown
R7897:Gm11639	UTSW	11	104998235	missense	probably benign	0.24
R7936:Gm11639	UTSW	11	104999698	missense	possibly damaging	0.89
R7936:Gm11639	UTSW	11	105046559	critical splice donor site	probably null
R7959:Gm11639	UTSW	11	105042801	missense	probably damaging	0.96
R8031:Gm11639	UTSW	11	104881469	missense	possibly damaging	0.49
R8041:Gm11639	UTSW	11	104919479	missense	unknown
R8054:Gm11639	UTSW	11	104730400	missense	probably benign	0.07
R8056:Gm11639	UTSW	11	104909070	missense	probably damaging	0.98
R8088:Gm11639	UTSW	11	104998246	missense	probably benign	0.10
R8112:Gm11639	UTSW	11	104950200	missense	unknown
R8340:Gm11639	UTSW	11	104986030	missense	unknown
R8405:Gm11639	UTSW	11	104721198	missense	probably benign	0.02
R8413:Gm11639	UTSW	11	104920309	missense	unknown
R8472:Gm11639	UTSW	11	104818637	missense	probably benign	0.07
R8549:Gm11639	UTSW	11	104999695	missense	probably damaging	0.99
R8699:Gm11639	UTSW	11	104781246	missense	probably benign	0.03
R8711:Gm11639	UTSW	11	104852545	missense	probably benign	0.03
R8732:Gm11639	UTSW	11	104804274	missense	probably benign	0.03
R8745:Gm11639	UTSW	11	104858478	missense	possibly damaging	0.57
R8806:Gm11639	UTSW	11	105037869	missense	probably benign	0.07
R8810:Gm11639	UTSW	11	104914895	missense	unknown
R8845:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R8870:Gm11639	UTSW	11	104900674	missense	probably benign	0.07
R8872:Gm11639	UTSW	11	104870054	missense	probably benign	0.19
R8879:Gm11639	UTSW	11	104690955	missense	probably benign	0.03
R8924:Gm11639	UTSW	11	104915427	frame shift	probably null
R8954:Gm11639	UTSW	11	105018699	critical splice donor site	probably null
R8960:Gm11639	UTSW	11	104929946	splice site	probably benign
R8975:Gm11639	UTSW	11	105063589	missense	probably benign	0.17
R8988:Gm11639	UTSW	11	105020526	missense	probably benign	0.07
R8998:Gm11639	UTSW	11	104749651	missense	probably benign	0.09
R8999:Gm11639	UTSW	11	104749651	missense	probably benign	0.09
R9002:Gm11639	UTSW	11	105029996	missense	probably damaging	0.99
R9012:Gm11639	UTSW	11	104820521	critical splice donor site	probably null
R9036:Gm11639	UTSW	11	105036775	missense	probably benign	0.03
R9037:Gm11639	UTSW	11	104912965	missense	unknown
R9059:Gm11639	UTSW	11	104751863	missense	possibly damaging	0.73
R9066:Gm11639	UTSW	11	104740862	intron	probably benign
R9122:Gm11639	UTSW	11	104965779	missense	unknown
R9125:Gm11639	UTSW	11	104845534	missense	probably damaging	1.00
R9127:Gm11639	UTSW	11	104850581	missense	probably benign	0.07
R9171:Gm11639	UTSW	11	104909882	missense	probably benign	0.36
R9219:Gm11639	UTSW	11	104945865	missense	unknown
R9224:Gm11639	UTSW	11	104770975	missense	probably benign	0.07
R9235:Gm11639	UTSW	11	105017161	missense	probably benign	0.19
R9294:Gm11639	UTSW	11	104831300	missense	probably benign	0.24
R9318:Gm11639	UTSW	11	104965822	critical splice donor site	probably null
R9322:Gm11639	UTSW	11	104874373	missense	probably benign	0.36
R9361:Gm11639	UTSW	11	105005698	missense	probably benign	0.03
R9408:Gm11639	UTSW	11	104730429	critical splice donor site	probably null
R9434:Gm11639	UTSW	11	105009037	missense	probably benign	0.24
R9477:Gm11639	UTSW	11	104945872	missense	unknown
R9658:Gm11639	UTSW	11	104720294	missense	probably benign	0.03
R9719:Gm11639	UTSW	11	104977086	missense	unknown
R9751:Gm11639	UTSW	11	104893085	missense	probably benign	0.19
R9763:Gm11639	UTSW	11	104999659	missense	possibly damaging	0.89
X0026:Gm11639	UTSW	11	104720975	missense	probably benign	0.07
Z1088:Gm11639	UTSW	11	104751902	missense	probably damaging	0.96
Z1176:Gm11639	UTSW	11	105001967	missense	probably benign	0.29
Z1177:Gm11639	UTSW	11	104739338	nonsense	probably null
Z1177:Gm11639	UTSW	11	104820518	missense	probably benign	0.03
Z1177:Gm11639	UTSW	11	104924019	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAAGTCACCGGATAGACGTG -3'
(R):5'- AGAGTCTGCATACCAAAAGTAGTG -3'

Sequencing Primer
(F):5'- CCGGATAGACGTGATTCAAGTCTC -3'
(R):5'- GGTTACACAGGCTGACAATTAAAATG -3'

Posted On

2014-06-23