Mutagenetix > Incidental Mutation

Incidental Mutation 'R1818:Ap3b1'

204641

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

039846-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R1818 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94471704 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 561 (N561S)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022196
AA Change: N561S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N561S

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000231916

Coding Region Coverage

1x: 97.3%
3x: 96.6%
10x: 94.5%
20x: 90.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,075,858		probably null	Het
Adam6b	T	A	12: 113,491,256	N564K	probably benign	Het
Ahi1	A	G	10: 20,988,562	Y731C	probably damaging	Het
Ankk1	A	G	9: 49,420,425	Y190H	probably benign	Het
Ankmy1	T	A	1: 92,886,831	D318V	probably benign	Het
Ankrd33b	G	A	15: 31,367,121	A91V	probably damaging	Het
Apob	A	G	12: 8,006,834	N1739S	probably damaging	Het
Apob	A	G	12: 8,013,064	T236A	possibly damaging	Het
Birc6	G	A	17: 74,649,849	A3593T	probably damaging	Het
Bnc2	A	G	4: 84,291,874	F778L	possibly damaging	Het
Capn2	T	A	1: 182,472,597	K609N	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Card11	A	T	5: 140,885,560	D729E	probably benign	Het
Ccl20	A	G	1: 83,117,808	Y30C	probably damaging	Het
Cd209a	G	A	8: 3,745,576	T106I	probably damaging	Het
Cebpz	A	G	17: 78,935,376	L283P	probably damaging	Het
Cecr2	A	G	6: 120,731,267	T77A	probably damaging	Het
Clec4e	T	A	6: 123,285,493	D155V	possibly damaging	Het
Col25a1	G	A	3: 130,585,737		probably null	Het
Cyp2j11	A	T	4: 96,297,739	V403D	probably damaging	Het
Cyp4v3	G	A	8: 45,315,636	R296C	possibly damaging	Het
Ddx59	A	G	1: 136,432,507	I420V	probably damaging	Het
Denr	T	A	5: 123,917,220	D49E	probably benign	Het
Dnaaf3	A	T	7: 4,523,569		probably null	Het
Dnaaf3	G	T	7: 4,523,570	L503M	probably benign	Het
Dnah7a	A	C	1: 53,559,148	D1409E	probably benign	Het
Ehd4	C	T	2: 120,102,404	W180*	probably null	Het
Ephb2	A	G	4: 136,655,336	S984P	probably benign	Het
Eva1a	T	C	6: 82,071,144	M1T	probably null	Het
Fam90a1a	C	G	8: 21,963,771	P381A	possibly damaging	Het
Fam90a1a	C	A	8: 21,963,772	P381Q	probably damaging	Het
Flnc	T	C	6: 29,457,448	Y2382H	probably damaging	Het
Flrt1	A	T	19: 7,095,346	L612Q	probably damaging	Het
Fubp1	T	A	3: 152,222,169	N419K	probably damaging	Het
Gin1	A	G	1: 97,785,226		probably null	Het
Gm11639	T	A	11: 104,721,507	L652Q	probably benign	Het
Gm4847	T	A	1: 166,638,219	H267L	probably damaging	Het
Golga4	T	G	9: 118,572,987	V91G	probably damaging	Het
Hip1r	T	C	5: 123,995,955		probably null	Het
Ice2	A	G	9: 69,432,101	S967G	probably benign	Het
Il18rap	A	G	1: 40,531,527	I210V	probably benign	Het
Impdh2	T	G	9: 108,563,212		probably null	Het
Inmt	C	A	6: 55,173,419	V78F	possibly damaging	Het
Inpp5e	T	C	2: 26,397,874	S637G	probably benign	Het
Kansl1	T	C	11: 104,342,457	H748R	possibly damaging	Het
Kif28	T	C	1: 179,705,754	K541E	possibly damaging	Het
Kifc1	G	A	17: 33,884,711	R195C	probably benign	Het
Kifc2	T	C	15: 76,666,081	V480A	probably damaging	Het
Lrrc74a	T	C	12: 86,737,710	Y71H	probably damaging	Het
Ly75	T	G	2: 60,311,777	T1330P	probably damaging	Het
Macf1	A	G	4: 123,376,417	V6647A	probably damaging	Het
Mgat1	T	C	11: 49,261,284	I198T	possibly damaging	Het
Morc3	A	G	16: 93,855,510	Y367C	probably damaging	Het
Mpp6	T	G	6: 50,163,431	F144V	probably benign	Het
Mtfr1	A	G	3: 19,215,673	T162A	probably damaging	Het
Myrip	C	T	9: 120,388,162	S49L	probably damaging	Het
Nup153	A	T	13: 46,681,637	N1397K	possibly damaging	Het
Olfr196	T	C	16: 59,167,880	K88E	probably benign	Het
Olfr883	T	C	9: 38,026,507	S234P	probably damaging	Het
Olfr935	T	C	9: 38,994,606	I276M	possibly damaging	Het
Olfr986	T	C	9: 40,187,262	V49A	probably benign	Het
Pabpc2	G	T	18: 39,774,110	V143L	probably damaging	Het
Panx3	T	C	9: 37,664,026	K180R	probably benign	Het
Patj	G	A	4: 98,623,648	V144M	possibly damaging	Het
Pde1c	T	A	6: 56,126,892	K651*	probably null	Het
Pde4c	A	G	8: 70,726,989	H63R	probably benign	Het
Pdha2	T	A	3: 141,211,199	K183*	probably null	Het
Pkd1l3	T	A	8: 109,648,406	C1504S	probably benign	Het
Plbd2	A	T	5: 120,487,509		probably null	Het
Poteg	G	A	8: 27,450,167	W121*	probably null	Het
Prf1	C	A	10: 61,302,983	T240N	probably damaging	Het
Ptprf	A	G	4: 118,209,871	Y1883H	probably damaging	Het
Puf60	T	C	15: 76,071,474	T322A	possibly damaging	Het
Rev3l	A	G	10: 39,828,424	I281M	probably benign	Het
Rufy1	T	C	11: 50,414,572	I305V	probably benign	Het
Shisa9	A	C	16: 12,267,562	Q329P	probably damaging	Het
Siglech	G	A	7: 55,768,584	R100Q	probably damaging	Het
Slc13a5	T	A	11: 72,253,343	Y303F	probably benign	Het
Snx6	C	T	12: 54,783,474	V67I	possibly damaging	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
Tecpr2	A	G	12: 110,926,454	Y310C	probably damaging	Het
Top1	T	A	2: 160,715,723	L575Q	probably damaging	Het
Usp16	C	T	16: 87,479,132	R452*	probably null	Het
Utrn	A	G	10: 12,709,964		probably null	Het
Vps13b	G	A	15: 35,877,577	G2899E	probably benign	Het
Wdr78	A	G	4: 103,072,657	V56A	possibly damaging	Het
Wipi2	T	A	5: 142,658,208	L115Q	probably damaging	Het
Zbtb7c	A	C	18: 76,137,525	E228A	probably damaging	Het
Zfp26	T	C	9: 20,442,191	T101A	probably benign	Het
Zfp593	A	T	4: 134,245,083		probably null	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zfp948	G	A	17: 21,584,807	V20M	probably damaging	Het
Zranb3	A	T	1: 128,017,556		probably null	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGCATTGGCTACAGAATTC -3'
(R):5'- TGTAGGCAGCGTGCTGTAAG -3'

Sequencing Primer
(F):5'- GGCTACAGAATTCCATTTGCCACG -3'
(R):5'- CAGCGTGCTGTAAGCTATGCATC -3'

Posted On

2014-06-23