Incidental Mutation 'R1818:Ap3b1'
ID 204641
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 039846-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R1818 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94608212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 561 (N561S)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect possibly damaging
Transcript: ENSMUST00000022196
AA Change: N561S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N561S

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231916
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,857 (GRCm39) probably null Het
Adam6b T A 12: 113,454,876 (GRCm39) N564K probably benign Het
Ahi1 A G 10: 20,864,461 (GRCm39) Y731C probably damaging Het
Ankk1 A G 9: 49,331,725 (GRCm39) Y190H probably benign Het
Ankmy1 T A 1: 92,814,553 (GRCm39) D318V probably benign Het
Ankrd33b G A 15: 31,367,267 (GRCm39) A91V probably damaging Het
Apob A G 12: 8,056,834 (GRCm39) N1739S probably damaging Het
Apob A G 12: 8,063,064 (GRCm39) T236A possibly damaging Het
Birc6 G A 17: 74,956,844 (GRCm39) A3593T probably damaging Het
Bnc2 A G 4: 84,210,111 (GRCm39) F778L possibly damaging Het
Capn2 T A 1: 182,300,162 (GRCm39) K609N probably benign Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Card11 A T 5: 140,871,315 (GRCm39) D729E probably benign Het
Ccl20 A G 1: 83,095,529 (GRCm39) Y30C probably damaging Het
Cd209a G A 8: 3,795,576 (GRCm39) T106I probably damaging Het
Cebpz A G 17: 79,242,805 (GRCm39) L283P probably damaging Het
Cecr2 A G 6: 120,708,228 (GRCm39) T77A probably damaging Het
Clec4e T A 6: 123,262,452 (GRCm39) D155V possibly damaging Het
Col25a1 G A 3: 130,379,386 (GRCm39) probably null Het
Cyp2j11 A T 4: 96,185,976 (GRCm39) V403D probably damaging Het
Cyp4v3 G A 8: 45,768,673 (GRCm39) R296C possibly damaging Het
Ddx59 A G 1: 136,360,245 (GRCm39) I420V probably damaging Het
Denr T A 5: 124,055,283 (GRCm39) D49E probably benign Het
Dnaaf3 A T 7: 4,526,568 (GRCm39) probably null Het
Dnaaf3 G T 7: 4,526,569 (GRCm39) L503M probably benign Het
Dnah7a A C 1: 53,598,307 (GRCm39) D1409E probably benign Het
Dnai4 A G 4: 102,929,854 (GRCm39) V56A possibly damaging Het
Efcab3 T A 11: 104,612,333 (GRCm39) L652Q probably benign Het
Ehd4 C T 2: 119,932,885 (GRCm39) W180* probably null Het
Ephb2 A G 4: 136,382,647 (GRCm39) S984P probably benign Het
Eva1a T C 6: 82,048,125 (GRCm39) M1T probably null Het
Fam90a1a C G 8: 22,453,787 (GRCm39) P381A possibly damaging Het
Fam90a1a C A 8: 22,453,788 (GRCm39) P381Q probably damaging Het
Flnc T C 6: 29,457,447 (GRCm39) Y2382H probably damaging Het
Flrt1 A T 19: 7,072,711 (GRCm39) L612Q probably damaging Het
Fubp1 T A 3: 151,927,806 (GRCm39) N419K probably damaging Het
Gin1 A G 1: 97,712,951 (GRCm39) probably null Het
Gm4847 T A 1: 166,465,788 (GRCm39) H267L probably damaging Het
Golga4 T G 9: 118,402,055 (GRCm39) V91G probably damaging Het
Hip1r T C 5: 124,134,018 (GRCm39) probably null Het
Ice2 A G 9: 69,339,383 (GRCm39) S967G probably benign Het
Il18rap A G 1: 40,570,687 (GRCm39) I210V probably benign Het
Impdh2 T G 9: 108,440,411 (GRCm39) probably null Het
Inmt C A 6: 55,150,404 (GRCm39) V78F possibly damaging Het
Inpp5e T C 2: 26,287,886 (GRCm39) S637G probably benign Het
Kansl1 T C 11: 104,233,283 (GRCm39) H748R possibly damaging Het
Kif28 T C 1: 179,533,319 (GRCm39) K541E possibly damaging Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Kifc2 T C 15: 76,550,281 (GRCm39) V480A probably damaging Het
Lrrc74a T C 12: 86,784,484 (GRCm39) Y71H probably damaging Het
Ly75 T G 2: 60,142,121 (GRCm39) T1330P probably damaging Het
Macf1 A G 4: 123,270,210 (GRCm39) V6647A probably damaging Het
Mgat1 T C 11: 49,152,111 (GRCm39) I198T possibly damaging Het
Morc3 A G 16: 93,652,398 (GRCm39) Y367C probably damaging Het
Mtfr1 A G 3: 19,269,837 (GRCm39) T162A probably damaging Het
Myrip C T 9: 120,217,228 (GRCm39) S49L probably damaging Het
Nup153 A T 13: 46,835,113 (GRCm39) N1397K possibly damaging Het
Or5h26 T C 16: 58,988,243 (GRCm39) K88E probably benign Het
Or6x1 T C 9: 40,098,558 (GRCm39) V49A probably benign Het
Or8b36 T C 9: 37,937,803 (GRCm39) S234P probably damaging Het
Or8g21 T C 9: 38,905,902 (GRCm39) I276M possibly damaging Het
Pabpc2 G T 18: 39,907,163 (GRCm39) V143L probably damaging Het
Pals2 T G 6: 50,140,411 (GRCm39) F144V probably benign Het
Panx3 T C 9: 37,575,322 (GRCm39) K180R probably benign Het
Patj G A 4: 98,511,885 (GRCm39) V144M possibly damaging Het
Pde1c T A 6: 56,103,877 (GRCm39) K651* probably null Het
Pde4c A G 8: 71,179,638 (GRCm39) H63R probably benign Het
Pdha2 T A 3: 140,916,960 (GRCm39) K183* probably null Het
Pkd1l3 T A 8: 110,375,038 (GRCm39) C1504S probably benign Het
Plbd2 A T 5: 120,625,574 (GRCm39) probably null Het
Poteg G A 8: 27,940,195 (GRCm39) W121* probably null Het
Prf1 C A 10: 61,138,762 (GRCm39) T240N probably damaging Het
Ptprf A G 4: 118,067,068 (GRCm39) Y1883H probably damaging Het
Puf60 T C 15: 75,943,323 (GRCm39) T322A possibly damaging Het
Rev3l A G 10: 39,704,420 (GRCm39) I281M probably benign Het
Rufy1 T C 11: 50,305,399 (GRCm39) I305V probably benign Het
Shisa9 A C 16: 12,085,426 (GRCm39) Q329P probably damaging Het
Siglech G A 7: 55,418,332 (GRCm39) R100Q probably damaging Het
Slc13a5 T A 11: 72,144,169 (GRCm39) Y303F probably benign Het
Snx6 C T 12: 54,830,259 (GRCm39) V67I possibly damaging Het
Spef2 C T 15: 9,584,194 (GRCm39) E1624K probably damaging Het
Tecpr2 A G 12: 110,892,888 (GRCm39) Y310C probably damaging Het
Top1 T A 2: 160,557,643 (GRCm39) L575Q probably damaging Het
Usp16 C T 16: 87,276,020 (GRCm39) R452* probably null Het
Utrn A G 10: 12,585,708 (GRCm39) probably null Het
Vps13b G A 15: 35,877,723 (GRCm39) G2899E probably benign Het
Wipi2 T A 5: 142,643,963 (GRCm39) L115Q probably damaging Het
Zbtb7c A C 18: 76,270,596 (GRCm39) E228A probably damaging Het
Zfp26 T C 9: 20,353,487 (GRCm39) T101A probably benign Het
Zfp593 A T 4: 133,972,394 (GRCm39) probably null Het
Zfp646 G A 7: 127,482,292 (GRCm39) G1490S probably benign Het
Zfp948 G A 17: 21,805,069 (GRCm39) V20M probably damaging Het
Zranb3 A T 1: 127,945,293 (GRCm39) probably null Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0346:Ap3b1 UTSW 13 94,582,479 (GRCm39) nonsense probably null
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1791:Ap3b1 UTSW 13 94,545,305 (GRCm39) missense possibly damaging 0.63
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4626:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R5941:Ap3b1 UTSW 13 94,576,781 (GRCm39) missense probably benign 0.02
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8492:Ap3b1 UTSW 13 94,531,294 (GRCm39) missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9065:Ap3b1 UTSW 13 94,608,223 (GRCm39) missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCATTGGCTACAGAATTC -3'
(R):5'- TGTAGGCAGCGTGCTGTAAG -3'

Sequencing Primer
(F):5'- GGCTACAGAATTCCATTTGCCACG -3'
(R):5'- CAGCGTGCTGTAAGCTATGCATC -3'
Posted On 2014-06-23