Incidental Mutation 'R1818:Vps13b'
ID 204645
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 039846-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1818 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 35371160-35931229 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35877577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 2899 (G2899E)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048646
AA Change: G2899E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: G2899E

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228738
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,858 probably null Het
Adam6b T A 12: 113,491,256 N564K probably benign Het
Ahi1 A G 10: 20,988,562 Y731C probably damaging Het
Ankk1 A G 9: 49,420,425 Y190H probably benign Het
Ankmy1 T A 1: 92,886,831 D318V probably benign Het
Ankrd33b G A 15: 31,367,121 A91V probably damaging Het
Ap3b1 A G 13: 94,471,704 N561S possibly damaging Het
Apob A G 12: 8,006,834 N1739S probably damaging Het
Apob A G 12: 8,013,064 T236A possibly damaging Het
Birc6 G A 17: 74,649,849 A3593T probably damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccl20 A G 1: 83,117,808 Y30C probably damaging Het
Cd209a G A 8: 3,745,576 T106I probably damaging Het
Cebpz A G 17: 78,935,376 L283P probably damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Clec4e T A 6: 123,285,493 D155V possibly damaging Het
Col25a1 G A 3: 130,585,737 probably null Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Denr T A 5: 123,917,220 D49E probably benign Het
Dnaaf3 A T 7: 4,523,569 probably null Het
Dnaaf3 G T 7: 4,523,570 L503M probably benign Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Ehd4 C T 2: 120,102,404 W180* probably null Het
Ephb2 A G 4: 136,655,336 S984P probably benign Het
Eva1a T C 6: 82,071,144 M1T probably null Het
Fam90a1a C G 8: 21,963,771 P381A possibly damaging Het
Fam90a1a C A 8: 21,963,772 P381Q probably damaging Het
Flnc T C 6: 29,457,448 Y2382H probably damaging Het
Flrt1 A T 19: 7,095,346 L612Q probably damaging Het
Fubp1 T A 3: 152,222,169 N419K probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm11639 T A 11: 104,721,507 L652Q probably benign Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Golga4 T G 9: 118,572,987 V91G probably damaging Het
Hip1r T C 5: 123,995,955 probably null Het
Ice2 A G 9: 69,432,101 S967G probably benign Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Impdh2 T G 9: 108,563,212 probably null Het
Inmt C A 6: 55,173,419 V78F possibly damaging Het
Inpp5e T C 2: 26,397,874 S637G probably benign Het
Kansl1 T C 11: 104,342,457 H748R possibly damaging Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Kifc2 T C 15: 76,666,081 V480A probably damaging Het
Lrrc74a T C 12: 86,737,710 Y71H probably damaging Het
Ly75 T G 2: 60,311,777 T1330P probably damaging Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mgat1 T C 11: 49,261,284 I198T possibly damaging Het
Morc3 A G 16: 93,855,510 Y367C probably damaging Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Mtfr1 A G 3: 19,215,673 T162A probably damaging Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nup153 A T 13: 46,681,637 N1397K possibly damaging Het
Olfr196 T C 16: 59,167,880 K88E probably benign Het
Olfr883 T C 9: 38,026,507 S234P probably damaging Het
Olfr935 T C 9: 38,994,606 I276M possibly damaging Het
Olfr986 T C 9: 40,187,262 V49A probably benign Het
Pabpc2 G T 18: 39,774,110 V143L probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Patj G A 4: 98,623,648 V144M possibly damaging Het
Pde1c T A 6: 56,126,892 K651* probably null Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdha2 T A 3: 141,211,199 K183* probably null Het
Pkd1l3 T A 8: 109,648,406 C1504S probably benign Het
Plbd2 A T 5: 120,487,509 probably null Het
Poteg G A 8: 27,450,167 W121* probably null Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Ptprf A G 4: 118,209,871 Y1883H probably damaging Het
Puf60 T C 15: 76,071,474 T322A possibly damaging Het
Rev3l A G 10: 39,828,424 I281M probably benign Het
Rufy1 T C 11: 50,414,572 I305V probably benign Het
Shisa9 A C 16: 12,267,562 Q329P probably damaging Het
Siglech G A 7: 55,768,584 R100Q probably damaging Het
Slc13a5 T A 11: 72,253,343 Y303F probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Tecpr2 A G 12: 110,926,454 Y310C probably damaging Het
Top1 T A 2: 160,715,723 L575Q probably damaging Het
Usp16 C T 16: 87,479,132 R452* probably null Het
Utrn A G 10: 12,709,964 probably null Het
Wdr78 A G 4: 103,072,657 V56A possibly damaging Het
Wipi2 T A 5: 142,658,208 L115Q probably damaging Het
Zbtb7c A C 18: 76,137,525 E228A probably damaging Het
Zfp26 T C 9: 20,442,191 T101A probably benign Het
Zfp593 A T 4: 134,245,083 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp948 G A 17: 21,584,807 V20M probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
R7400:Vps13b UTSW 15 35378900 missense probably damaging 1.00
R7414:Vps13b UTSW 15 35910827 missense probably damaging 1.00
R7497:Vps13b UTSW 15 35876697 missense probably benign 0.38
R7500:Vps13b UTSW 15 35910524 missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35576439 missense probably damaging 0.98
R7605:Vps13b UTSW 15 35770646 missense probably damaging 0.97
R7849:Vps13b UTSW 15 35423232 missense probably damaging 0.99
R7984:Vps13b UTSW 15 35879913 missense probably benign
R8094:Vps13b UTSW 15 35668906 critical splice donor site probably null
R8097:Vps13b UTSW 15 35709346 missense probably benign 0.38
R8131:Vps13b UTSW 15 35372109 critical splice donor site probably null
R8139:Vps13b UTSW 15 35607272 nonsense probably null
R8174:Vps13b UTSW 15 35709310 nonsense probably null
R8225:Vps13b UTSW 15 35794382 missense probably damaging 0.99
R8239:Vps13b UTSW 15 35597404 missense probably damaging 1.00
R8244:Vps13b UTSW 15 35917203 missense probably damaging 1.00
R8303:Vps13b UTSW 15 35639917 missense probably damaging 1.00
R8311:Vps13b UTSW 15 35886954 missense probably benign 0.37
R8443:Vps13b UTSW 15 35455100 missense probably benign
R8494:Vps13b UTSW 15 35422448 missense probably damaging 0.99
R8499:Vps13b UTSW 15 35841320 missense probably damaging 1.00
R8506:Vps13b UTSW 15 35446745 missense probably benign 0.31
R8559:Vps13b UTSW 15 35876642 missense probably damaging 1.00
R8686:Vps13b UTSW 15 35925389 missense probably damaging 0.99
R8782:Vps13b UTSW 15 35422337 missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35472066 critical splice donor site probably benign
R8824:Vps13b UTSW 15 35533299 missense probably damaging 0.99
R9024:Vps13b UTSW 15 35923324 missense probably damaging 0.97
R9038:Vps13b UTSW 15 35875785 missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35422391 missense probably damaging 1.00
R9091:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9129:Vps13b UTSW 15 35448647 missense probably damaging 1.00
R9214:Vps13b UTSW 15 35623746 missense probably damaging 0.99
R9237:Vps13b UTSW 15 35841333 missense probably damaging 1.00
R9256:Vps13b UTSW 15 35623779 missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9279:Vps13b UTSW 15 35572144 missense probably damaging 0.97
R9291:Vps13b UTSW 15 35846913 missense probably damaging 1.00
R9342:Vps13b UTSW 15 35455054 missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35876419 missense probably damaging 1.00
R9488:Vps13b UTSW 15 35447734 missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35841311 missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35623628 missense probably benign 0.00
R9674:Vps13b UTSW 15 35607234 missense probably damaging 0.98
R9696:Vps13b UTSW 15 35674887 missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35910257 missense probably damaging 1.00
R9797:Vps13b UTSW 15 35674876 missense probably damaging 1.00
RF020:Vps13b UTSW 15 35925406 missense probably null 1.00
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Z1177:Vps13b UTSW 15 35668885 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGAGAATACCCCACAGAAC -3'
(R):5'- TAGGCCATCCTCTGCTACAT -3'

Sequencing Primer
(F):5'- TCCAGAGGTCCTGAGTTCAAATC -3'
(R):5'- CTCTGCTACATATGCAGCTAGAG -3'
Posted On 2014-06-23