Mutagenetix > Incidental Mutation

Incidental Mutation 'R1819:Plxna2'

204676

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

039847-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1819 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 194790186 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1079 (N1079K)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000027952
AA Change: N1079K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: N1079K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135664

SMART Domains

Protein: ENSMUSP00000118087
Gene: ENSMUSG00000026640

Domain	Start	End	E-Value	Type
PSI	9	62	1.24e-8	SMART

Meta Mutation Damage Score

0.0897

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.9%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,981,056		probably null	Het
Abhd17a	T	C	10: 80,586,636	T71A	probably benign	Het
Acad11	G	A	9: 104,114,539		probably null	Het
Adgrf1	C	A	17: 43,310,033	T387K	probably benign	Het
Afdn	A	G	17: 13,850,848	T783A	probably damaging	Het
Akap13	T	A	7: 75,608,705	M359K	probably benign	Het
Asxl3	A	T	18: 22,522,376	N1148Y	probably damaging	Het
Atl1	T	C	12: 69,963,300	S547P	probably benign	Het
Bace1	A	T	9: 45,857,162	T252S	possibly damaging	Het
BC034090	A	G	1: 155,225,829	S230P	possibly damaging	Het
Bnc2	A	G	4: 84,291,874	F778L	possibly damaging	Het
Capn2	T	A	1: 182,472,597	K609N	probably benign	Het
Capn8	T	A	1: 182,598,826	I242N	probably damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Ccdc180	A	G	4: 45,926,195	E1135G	possibly damaging	Het
Ccdc181	C	T	1: 164,282,478	Q385*	probably null	Het
Cdh10	G	T	15: 18,991,965	G437*	probably null	Het
Ceacam1	T	A	7: 25,463,860	Q316L	possibly damaging	Het
Cecr2	A	G	6: 120,731,267	T77A	probably damaging	Het
Cers4	T	A	8: 4,521,232	M267K	probably benign	Het
Csmd3	T	C	15: 47,753,735	D1930G	possibly damaging	Het
Cyp2j11	A	T	4: 96,297,739	V403D	probably damaging	Het
Cyp4v3	G	A	8: 45,315,636	R296C	possibly damaging	Het
Ddx59	A	G	1: 136,432,507	I420V	probably damaging	Het
Dnah5	T	A	15: 28,246,400	L628*	probably null	Het
Dnah7a	A	C	1: 53,559,148	D1409E	probably benign	Het
Dus2	T	A	8: 106,051,848	W377R	probably damaging	Het
E330034G19Rik	A	G	14: 24,298,013	D111G	probably damaging	Het
Erich4	C	T	7: 25,615,290	R66Q	possibly damaging	Het
Fcgbp	G	T	7: 28,085,283	R256L	probably benign	Het
Fdxr	A	T	11: 115,276,104	F53Y	probably damaging	Het
Fkbp10	G	T	11: 100,415,889	A36S	probably benign	Het
Foxo3	A	T	10: 42,197,611	D84E	probably benign	Het
Gin1	A	G	1: 97,785,226		probably null	Het
Gli3	C	T	13: 15,725,792	Q1255*	probably null	Het
Gm4847	T	A	1: 166,638,219	H267L	probably damaging	Het
Gpr171	T	C	3: 59,097,920	I145V	probably benign	Het
Gpr68	T	A	12: 100,878,403	H294L	possibly damaging	Het
Gys2	T	C	6: 142,461,186	E148G	probably damaging	Het
Heatr5b	T	C	17: 78,791,511	D1320G	probably damaging	Het
Ifnlr1	G	T	4: 135,686,523		probably benign	Het
Ift88	G	A	14: 57,455,519	E392K	probably damaging	Het
Igsf9b	T	A	9: 27,311,593	S97T	probably damaging	Het
Il18rap	A	G	1: 40,531,527	I210V	probably benign	Het
Kcnj11	C	T	7: 46,099,156	G248S	probably benign	Het
Kif28	T	C	1: 179,705,754	K541E	possibly damaging	Het
Lilrb4a	A	G	10: 51,496,028	Y205C	probably damaging	Het
Lima1	T	A	15: 99,819,936	H63L	probably benign	Het
Lonrf3	A	G	X: 36,358,708	I687V	probably damaging	Het
Lrba	A	G	3: 86,542,634	T2099A	possibly damaging	Het
Morn5	C	T	2: 36,052,975	T29M	probably damaging	Het
Neurl1b	G	A	17: 26,438,700	R22H	probably benign	Het
Nr2e3	T	C	9: 59,943,437	I380V	probably damaging	Het
Oas1c	G	A	5: 120,808,735	A10V	possibly damaging	Het
Olfr395	T	C	11: 73,906,679	E271G	probably benign	Het
Olfr671	C	T	7: 104,975,398	V196I	probably benign	Het
P3h3	T	C	6: 124,854,932	T297A	probably benign	Het
Pdpk1	T	C	17: 24,110,904	K53E	probably damaging	Het
Plec	C	T	15: 76,179,906	R2056Q	probably damaging	Het
Prr12	G	C	7: 45,048,697		probably benign	Het
Psip1	A	G	4: 83,458,163	S480P	probably benign	Het
Ptpre	A	G	7: 135,668,993		probably benign	Het
Pvalb	A	C	15: 78,202,584	V44G	probably damaging	Het
Rab3c	T	G	13: 110,084,135	Q164P	possibly damaging	Het
Rubcn	T	C	16: 32,826,914	K703R	possibly damaging	Het
Setd7	T	G	3: 51,542,639	H122P	probably benign	Het
Slc26a8	A	T	17: 28,684,834	F19I	probably benign	Het
Slc6a14	A	G	X: 21,741,047	D625G	probably benign	Het
Snx6	C	T	12: 54,783,474	V67I	possibly damaging	Het
Syngr3	A	G	17: 24,687,722	F40L	possibly damaging	Het
Syt8	G	A	7: 142,438,234	G21R	possibly damaging	Het
Tagln	A	G	9: 45,930,840	F152L	probably benign	Het
Tcf12	G	A	9: 72,109,717	T36M	probably damaging	Het
Tdrd6	C	T	17: 43,626,551	S1202N	probably benign	Het
Tekt2	T	C	4: 126,323,736	K179E	probably damaging	Het
Tekt4	G	T	17: 25,473,811		probably null	Het
Tmprss5	G	T	9: 49,107,164	R98L	probably benign	Het
Tns1	G	T	1: 73,916,476		probably benign	Het
Tpcn1	A	C	5: 120,536,227		probably null	Het
Ttc6	T	C	12: 57,694,500		probably null	Het
Ttf1	A	G	2: 29,074,784	N706S	possibly damaging	Het
Washc4	C	T	10: 83,550,884	T124I	probably benign	Het
Wdr17	A	T	8: 54,690,124	S140T	probably benign	Het
Wdr19	A	T	5: 65,212,891	I123F	possibly damaging	Het
Zer1	C	T	2: 30,110,218	A317T	probably benign	Het
Zfp474	A	G	18: 52,638,800	D175G	probably damaging	Het
Zfp598	T	C	17: 24,681,130		probably benign	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zranb3	A	T	1: 128,017,556		probably null	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATGGTGTTACAGAACCCTACAGTTC -3'
(R):5'- GCTGCCAGCACTTTTAGACC -3'

Sequencing Primer
(F):5'- CTACAGTTCAAGGGTGGCTC -3'
(R):5'- CATCACATTAGTTTCTGGATGGTTC -3'

Posted On

2014-06-23