Incidental Mutation 'R1819:Cers4'
ID204706
Institutional Source Beutler Lab
Gene Symbol Cers4
Ensembl Gene ENSMUSG00000008206
Gene Nameceramide synthase 4
SynonymsLass4, CerS4, Trh1, 2900019C14Rik
MMRRC Submission 039847-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1819 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4493026-4531680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4521232 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 267 (M267K)
Ref Sequence ENSEMBL: ENSMUSP00000008350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008350] [ENSMUST00000176130]
Predicted Effect probably benign
Transcript: ENSMUST00000008350
AA Change: M267K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000008350
Gene: ENSMUSG00000008206
AA Change: M267K

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175781
SMART Domains Protein: ENSMUSP00000138819
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176130
SMART Domains Protein: ENSMUSP00000135652
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
transmembrane domain 39 56 N/A INTRINSIC
HOX 75 132 1.2e-4 SMART
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177010
SMART Domains Protein: ENSMUSP00000135763
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
Blast:TLC 4 58 7e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193830
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 100% (91/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered lipid composition of the sebum and hair follicle dystrophy that results in a progressive form of alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,981,056 probably null Het
Abhd17a T C 10: 80,586,636 T71A probably benign Het
Acad11 G A 9: 104,114,539 probably null Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afdn A G 17: 13,850,848 T783A probably damaging Het
Akap13 T A 7: 75,608,705 M359K probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atl1 T C 12: 69,963,300 S547P probably benign Het
Bace1 A T 9: 45,857,162 T252S possibly damaging Het
BC034090 A G 1: 155,225,829 S230P possibly damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Capn8 T A 1: 182,598,826 I242N probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc180 A G 4: 45,926,195 E1135G possibly damaging Het
Ccdc181 C T 1: 164,282,478 Q385* probably null Het
Cdh10 G T 15: 18,991,965 G437* probably null Het
Ceacam1 T A 7: 25,463,860 Q316L possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Csmd3 T C 15: 47,753,735 D1930G possibly damaging Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dus2 T A 8: 106,051,848 W377R probably damaging Het
E330034G19Rik A G 14: 24,298,013 D111G probably damaging Het
Erich4 C T 7: 25,615,290 R66Q possibly damaging Het
Fcgbp G T 7: 28,085,283 R256L probably benign Het
Fdxr A T 11: 115,276,104 F53Y probably damaging Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Foxo3 A T 10: 42,197,611 D84E probably benign Het
Gin1 A G 1: 97,785,226 probably null Het
Gli3 C T 13: 15,725,792 Q1255* probably null Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Gpr171 T C 3: 59,097,920 I145V probably benign Het
Gpr68 T A 12: 100,878,403 H294L possibly damaging Het
Gys2 T C 6: 142,461,186 E148G probably damaging Het
Heatr5b T C 17: 78,791,511 D1320G probably damaging Het
Ifnlr1 G T 4: 135,686,523 probably benign Het
Ift88 G A 14: 57,455,519 E392K probably damaging Het
Igsf9b T A 9: 27,311,593 S97T probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kcnj11 C T 7: 46,099,156 G248S probably benign Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Lilrb4a A G 10: 51,496,028 Y205C probably damaging Het
Lima1 T A 15: 99,819,936 H63L probably benign Het
Lonrf3 A G X: 36,358,708 I687V probably damaging Het
Lrba A G 3: 86,542,634 T2099A possibly damaging Het
Morn5 C T 2: 36,052,975 T29M probably damaging Het
Neurl1b G A 17: 26,438,700 R22H probably benign Het
Nr2e3 T C 9: 59,943,437 I380V probably damaging Het
Oas1c G A 5: 120,808,735 A10V possibly damaging Het
Olfr395 T C 11: 73,906,679 E271G probably benign Het
Olfr671 C T 7: 104,975,398 V196I probably benign Het
P3h3 T C 6: 124,854,932 T297A probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Plec C T 15: 76,179,906 R2056Q probably damaging Het
Plxna2 T A 1: 194,790,186 N1079K probably benign Het
Prr12 G C 7: 45,048,697 probably benign Het
Psip1 A G 4: 83,458,163 S480P probably benign Het
Ptpre A G 7: 135,668,993 probably benign Het
Pvalb A C 15: 78,202,584 V44G probably damaging Het
Rab3c T G 13: 110,084,135 Q164P possibly damaging Het
Rubcn T C 16: 32,826,914 K703R possibly damaging Het
Setd7 T G 3: 51,542,639 H122P probably benign Het
Slc26a8 A T 17: 28,684,834 F19I probably benign Het
Slc6a14 A G X: 21,741,047 D625G probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Syngr3 A G 17: 24,687,722 F40L possibly damaging Het
Syt8 G A 7: 142,438,234 G21R possibly damaging Het
Tagln A G 9: 45,930,840 F152L probably benign Het
Tcf12 G A 9: 72,109,717 T36M probably damaging Het
Tdrd6 C T 17: 43,626,551 S1202N probably benign Het
Tekt2 T C 4: 126,323,736 K179E probably damaging Het
Tekt4 G T 17: 25,473,811 probably null Het
Tmprss5 G T 9: 49,107,164 R98L probably benign Het
Tns1 G T 1: 73,916,476 probably benign Het
Tpcn1 A C 5: 120,536,227 probably null Het
Ttc6 T C 12: 57,694,500 probably null Het
Ttf1 A G 2: 29,074,784 N706S possibly damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr17 A T 8: 54,690,124 S140T probably benign Het
Wdr19 A T 5: 65,212,891 I123F possibly damaging Het
Zer1 C T 2: 30,110,218 A317T probably benign Het
Zfp474 A G 18: 52,638,800 D175G probably damaging Het
Zfp598 T C 17: 24,681,130 probably benign Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Cers4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cers4 APN 8 4521216 missense probably benign 0.13
IGL02407:Cers4 APN 8 4520306 nonsense probably null
IGL03244:Cers4 APN 8 4516878 missense probably damaging 0.99
Radlauer UTSW 8 4519475 missense probably damaging 1.00
willis UTSW 8 4518269 nonsense probably null
R1170:Cers4 UTSW 8 4519475 missense probably damaging 1.00
R1177:Cers4 UTSW 8 4516931 missense probably null 0.00
R1346:Cers4 UTSW 8 4515632 missense probably damaging 1.00
R1506:Cers4 UTSW 8 4520557 missense probably benign 0.30
R1652:Cers4 UTSW 8 4516908 unclassified probably null
R1952:Cers4 UTSW 8 4523461 nonsense probably null
R3790:Cers4 UTSW 8 4518285 missense possibly damaging 0.87
R4342:Cers4 UTSW 8 4521223 missense probably damaging 1.00
R5001:Cers4 UTSW 8 4515565 missense probably benign 0.33
R5338:Cers4 UTSW 8 4515680 missense probably damaging 0.98
R5785:Cers4 UTSW 8 4516992 critical splice donor site probably null
R5980:Cers4 UTSW 8 4518269 nonsense probably null
R6315:Cers4 UTSW 8 4516980 missense probably benign 0.02
R6891:Cers4 UTSW 8 4523731 missense probably damaging 0.99
R7554:Cers4 UTSW 8 4515718 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCTTACCTTAGTTCACATGGC -3'
(R):5'- GCATTACACTAGTGCTGCACTC -3'

Sequencing Primer
(F):5'- AGTTCACATGGCTTCACCCCATAG -3'
(R):5'- AGTGCTGCACTCAGTTTTCTG -3'
Posted On2014-06-23