Incidental Mutation 'R0111:Fam35a'
ID20471
Institutional Source Beutler Lab
Gene Symbol Fam35a
Ensembl Gene ENSMUSG00000041471
Gene Namefamily with sequence similarity 35, member A
Synonyms3110001K24Rik
MMRRC Submission 038397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0111 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location34237033-34310493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34267729 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 407 (K407E)
Ref Sequence ENSEMBL: ENSMUSP00000154080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111917] [ENSMUST00000227006] [ENSMUST00000227375] [ENSMUST00000228337] [ENSMUST00000228626] [ENSMUST00000228704]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111917
AA Change: K407E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107548
Gene: ENSMUSG00000041471
AA Change: K407E

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
Pfam:FAM35_C 694 866 4.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227006
Predicted Effect probably benign
Transcript: ENSMUST00000227375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228310
Predicted Effect probably benign
Transcript: ENSMUST00000228337
Predicted Effect probably damaging
Transcript: ENSMUST00000228626
AA Change: K407E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228704
Meta Mutation Damage Score 0.1586 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A T 17: 55,817,073 H491L possibly damaging Het
Adgrg3 T C 8: 95,035,110 probably benign Het
Arhgap5 T C 12: 52,559,960 probably benign Het
Asic1 T C 15: 99,696,983 Y334H probably damaging Het
Calcr T A 6: 3,717,157 D101V probably damaging Het
Cdh2 A T 18: 16,774,509 N57K probably benign Het
Clec4d C A 6: 123,268,047 Y95* probably null Het
Cracr2a A G 6: 127,604,061 T67A probably benign Het
Dennd5a A T 7: 109,934,754 V53D probably damaging Het
Dnah7a T C 1: 53,468,684 D3076G probably benign Het
Espnl T C 1: 91,344,742 M608T probably benign Het
Fam149a C T 8: 45,341,146 probably benign Het
Fam46c T C 3: 100,472,786 D218G probably damaging Het
Flnc T C 6: 29,454,340 V1884A probably damaging Het
Helz2 A C 2: 181,237,802 S674R probably benign Het
Hoxa2 T G 6: 52,164,487 probably null Het
Ifi47 T A 11: 49,096,070 N221K probably damaging Het
Ipo9 A G 1: 135,405,924 V340A probably damaging Het
Kalrn A T 16: 34,031,590 N373K probably damaging Het
Kif26a T C 12: 112,163,337 probably benign Het
Kiss1r A G 10: 79,918,689 T6A possibly damaging Het
Lama1 A T 17: 67,737,498 I131F probably damaging Het
Nefm T C 14: 68,124,542 D91G probably benign Het
Nos3 C T 5: 24,372,704 T572I probably damaging Het
Notch2 T C 3: 98,138,761 F1710L probably benign Het
Olfr70 T C 4: 43,696,648 N175S probably damaging Het
Olfr804 T A 10: 129,705,277 I133N probably damaging Het
Ostm1 T C 10: 42,679,258 L92P probably damaging Het
Pcdh15 T A 10: 74,626,819 Y1445* probably null Het
Pde1b T C 15: 103,503,513 S14P probably benign Het
Pitpna T C 11: 75,625,484 V265A probably benign Het
Plec G T 15: 76,178,646 T2476K probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppp3cc C T 14: 70,256,359 probably null Het
Prss36 A G 7: 127,934,545 L530P probably damaging Het
Ptpn13 T C 5: 103,580,763 probably benign Het
Ptpn23 T C 9: 110,385,623 D1570G probably damaging Het
Rab42 T C 4: 132,302,365 D182G possibly damaging Het
Rbm27 T A 18: 42,305,672 probably benign Het
Rp1 T C 1: 4,344,760 E2043G probably damaging Het
Rufy3 C T 5: 88,630,584 S341F probably damaging Het
Samd9l C T 6: 3,374,946 V772I possibly damaging Het
Scaper A G 9: 55,602,790 M654T probably benign Het
Sipa1l3 G A 7: 29,348,318 P333S probably damaging Het
Slc30a10 C A 1: 185,455,547 R162S probably benign Het
Spryd3 A T 15: 102,128,537 probably null Het
Tas2r110 T C 6: 132,868,203 F66L probably benign Het
Thap2 T C 10: 115,372,627 N196S probably benign Het
Themis2 C A 4: 132,789,925 R88L probably benign Het
Trip12 A T 1: 84,759,133 probably benign Het
Ube3b T A 5: 114,390,376 probably benign Het
Usp20 T A 2: 31,002,612 H64Q probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r15 T C 5: 109,287,156 R561G possibly damaging Het
Vsig10l A G 7: 43,468,101 D604G probably damaging Het
Wdr90 A G 17: 25,848,444 probably benign Het
Xirp2 A T 2: 67,508,378 N321I probably damaging Het
Zfp595 A G 13: 67,320,920 F11S possibly damaging Het
Zfp953 T A 13: 67,343,075 H271L probably damaging Het
Other mutations in Fam35a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Fam35a APN 14 34268625 missense probably benign 0.02
IGL00962:Fam35a APN 14 34249251 missense probably damaging 1.00
IGL01288:Fam35a APN 14 34259643 missense probably benign 0.00
IGL01302:Fam35a APN 14 34259727 missense probably benign 0.03
IGL01312:Fam35a APN 14 34268193 missense possibly damaging 0.56
IGL01444:Fam35a APN 14 34237557 missense probably damaging 1.00
IGL01633:Fam35a APN 14 34249179 missense probably damaging 1.00
IGL02251:Fam35a APN 14 34268278 missense probably benign 0.10
IGL02927:Fam35a APN 14 34267701 missense probably damaging 1.00
IGL03183:Fam35a APN 14 34245186 missense probably benign 0.02
IGL03226:Fam35a APN 14 34268371 missense probably benign 0.08
R1170:Fam35a UTSW 14 34268491 missense possibly damaging 0.92
R1348:Fam35a UTSW 14 34268923 missense probably damaging 1.00
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1538:Fam35a UTSW 14 34268876 missense probably damaging 1.00
R1602:Fam35a UTSW 14 34267650 missense probably damaging 1.00
R1650:Fam35a UTSW 14 34259617 intron probably benign
R1777:Fam35a UTSW 14 34268173 missense probably benign 0.07
R1843:Fam35a UTSW 14 34267803 missense probably benign 0.01
R2425:Fam35a UTSW 14 34268689 missense probably damaging 0.96
R3837:Fam35a UTSW 14 34249185 missense probably damaging 0.99
R3838:Fam35a UTSW 14 34245368 missense probably benign 0.01
R3904:Fam35a UTSW 14 34259709 missense probably damaging 1.00
R3964:Fam35a UTSW 14 34259687 missense probably damaging 1.00
R4322:Fam35a UTSW 14 34259675 missense probably damaging 0.99
R4708:Fam35a UTSW 14 34267833 missense probably benign 0.17
R4771:Fam35a UTSW 14 34268706 missense probably damaging 1.00
R4838:Fam35a UTSW 14 34268625 missense probably benign 0.02
R5448:Fam35a UTSW 14 34268370 missense probably benign 0.32
R5874:Fam35a UTSW 14 34245258 missense probably benign 0.08
R6332:Fam35a UTSW 14 34268172 missense probably benign 0.07
R6333:Fam35a UTSW 14 34267608 missense probably damaging 1.00
R6476:Fam35a UTSW 14 34268014 missense probably benign 0.27
R6576:Fam35a UTSW 14 34268242 missense probably damaging 1.00
R7172:Fam35a UTSW 14 34237568 missense probably damaging 1.00
R7574:Fam35a UTSW 14 34237466 missense probably damaging 1.00
R7725:Fam35a UTSW 14 34268704 missense possibly damaging 0.86
R7755:Fam35a UTSW 14 34248890 missense probably damaging 0.99
R7840:Fam35a UTSW 14 34237566 missense probably damaging 1.00
R7881:Fam35a UTSW 14 34267767 missense possibly damaging 0.63
R7923:Fam35a UTSW 14 34237566 missense probably damaging 1.00
R7964:Fam35a UTSW 14 34267767 missense possibly damaging 0.63
X0009:Fam35a UTSW 14 34245186 missense probably benign 0.02
Z1177:Fam35a UTSW 14 34241471 missense probably benign 0.31
Z1177:Fam35a UTSW 14 34268598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCAAGAAACACTGTAAGTGCC -3'
(R):5'- TGTGTAGCTCCCATCCAAGTACCG -3'

Sequencing Primer
(F):5'- TGTAAGTGCCCCAAATGCTG -3'
(R):5'- GTACCGCTAACAGGAGCTG -3'
Posted On2013-04-11