Incidental Mutation 'R1819:Bace1'
ID204711
Institutional Source Beutler Lab
Gene Symbol Bace1
Ensembl Gene ENSMUSG00000032086
Gene Namebeta-site APP cleaving enzyme 1
Synonyms
MMRRC Submission 039847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1819 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45838580-45864399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45857162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 252 (T252S)
Ref Sequence ENSEMBL: ENSMUSP00000034591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034591] [ENSMUST00000078111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034591
AA Change: T252S

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034591
Gene: ENSMUSG00000032086
AA Change: T252S

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 418 3.1e-46 PFAM
Pfam:TAXi_C 259 417 1.2e-13 PFAM
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078111
AA Change: T252S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077249
Gene: ENSMUSG00000032086
AA Change: T252S

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 295 9.5e-34 PFAM
Pfam:TAXi_C 290 383 1.5e-8 PFAM
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159499
SMART Domains Protein: ENSMUSP00000124773
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
Pfam:Asp 4 61 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162559
Predicted Effect unknown
Transcript: ENSMUST00000162587
AA Change: T110S
SMART Domains Protein: ENSMUSP00000124960
Gene: ENSMUSG00000032086
AA Change: T110S

DomainStartEndE-ValueType
Pfam:Asp 1 75 3.6e-9 PFAM
Pfam:Asp 78 277 3.3e-22 PFAM
Pfam:TAXi_C 118 276 1.4e-15 PFAM
transmembrane domain 314 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216609
Meta Mutation Damage Score 0.1297 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality. [provided by RefSeq, Nov 2015]
PHENOTYPE: Some alleles with a targeted mutation exhibit small body size, postnatal lethality, hyperactivity, decreased anxiety, and abnormal APP processing by neurons, while others appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,981,056 probably null Het
Abhd17a T C 10: 80,586,636 T71A probably benign Het
Acad11 G A 9: 104,114,539 probably null Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afdn A G 17: 13,850,848 T783A probably damaging Het
Akap13 T A 7: 75,608,705 M359K probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atl1 T C 12: 69,963,300 S547P probably benign Het
BC034090 A G 1: 155,225,829 S230P possibly damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Capn8 T A 1: 182,598,826 I242N probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc180 A G 4: 45,926,195 E1135G possibly damaging Het
Ccdc181 C T 1: 164,282,478 Q385* probably null Het
Cdh10 G T 15: 18,991,965 G437* probably null Het
Ceacam1 T A 7: 25,463,860 Q316L possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cers4 T A 8: 4,521,232 M267K probably benign Het
Csmd3 T C 15: 47,753,735 D1930G possibly damaging Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dus2 T A 8: 106,051,848 W377R probably damaging Het
E330034G19Rik A G 14: 24,298,013 D111G probably damaging Het
Erich4 C T 7: 25,615,290 R66Q possibly damaging Het
Fcgbp G T 7: 28,085,283 R256L probably benign Het
Fdxr A T 11: 115,276,104 F53Y probably damaging Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Foxo3 A T 10: 42,197,611 D84E probably benign Het
Gin1 A G 1: 97,785,226 probably null Het
Gli3 C T 13: 15,725,792 Q1255* probably null Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Gpr171 T C 3: 59,097,920 I145V probably benign Het
Gpr68 T A 12: 100,878,403 H294L possibly damaging Het
Gys2 T C 6: 142,461,186 E148G probably damaging Het
Heatr5b T C 17: 78,791,511 D1320G probably damaging Het
Ifnlr1 G T 4: 135,686,523 probably benign Het
Ift88 G A 14: 57,455,519 E392K probably damaging Het
Igsf9b T A 9: 27,311,593 S97T probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kcnj11 C T 7: 46,099,156 G248S probably benign Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Lilrb4a A G 10: 51,496,028 Y205C probably damaging Het
Lima1 T A 15: 99,819,936 H63L probably benign Het
Lonrf3 A G X: 36,358,708 I687V probably damaging Het
Lrba A G 3: 86,542,634 T2099A possibly damaging Het
Morn5 C T 2: 36,052,975 T29M probably damaging Het
Neurl1b G A 17: 26,438,700 R22H probably benign Het
Nr2e3 T C 9: 59,943,437 I380V probably damaging Het
Oas1c G A 5: 120,808,735 A10V possibly damaging Het
Olfr395 T C 11: 73,906,679 E271G probably benign Het
Olfr671 C T 7: 104,975,398 V196I probably benign Het
P3h3 T C 6: 124,854,932 T297A probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Plec C T 15: 76,179,906 R2056Q probably damaging Het
Plxna2 T A 1: 194,790,186 N1079K probably benign Het
Prr12 G C 7: 45,048,697 probably benign Het
Psip1 A G 4: 83,458,163 S480P probably benign Het
Ptpre A G 7: 135,668,993 probably benign Het
Pvalb A C 15: 78,202,584 V44G probably damaging Het
Rab3c T G 13: 110,084,135 Q164P possibly damaging Het
Rubcn T C 16: 32,826,914 K703R possibly damaging Het
Setd7 T G 3: 51,542,639 H122P probably benign Het
Slc26a8 A T 17: 28,684,834 F19I probably benign Het
Slc6a14 A G X: 21,741,047 D625G probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Syngr3 A G 17: 24,687,722 F40L possibly damaging Het
Syt8 G A 7: 142,438,234 G21R possibly damaging Het
Tagln A G 9: 45,930,840 F152L probably benign Het
Tcf12 G A 9: 72,109,717 T36M probably damaging Het
Tdrd6 C T 17: 43,626,551 S1202N probably benign Het
Tekt2 T C 4: 126,323,736 K179E probably damaging Het
Tekt4 G T 17: 25,473,811 probably null Het
Tmprss5 G T 9: 49,107,164 R98L probably benign Het
Tns1 G T 1: 73,916,476 probably benign Het
Tpcn1 A C 5: 120,536,227 probably null Het
Ttc6 T C 12: 57,694,500 probably null Het
Ttf1 A G 2: 29,074,784 N706S possibly damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr17 A T 8: 54,690,124 S140T probably benign Het
Wdr19 A T 5: 65,212,891 I123F possibly damaging Het
Zer1 C T 2: 30,110,218 A317T probably benign Het
Zfp474 A G 18: 52,638,800 D175G probably damaging Het
Zfp598 T C 17: 24,681,130 probably benign Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Bace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Bace1 APN 9 45839290 critical splice donor site probably null
IGL03378:Bace1 APN 9 45858901 splice site probably null
R0071:Bace1 UTSW 9 45854699 intron probably benign
R1561:Bace1 UTSW 9 45839194 missense probably benign 0.08
R2097:Bace1 UTSW 9 45860222 missense probably benign 0.00
R4067:Bace1 UTSW 9 45854664 missense probably damaging 1.00
R4864:Bace1 UTSW 9 45854811 missense probably damaging 1.00
R5814:Bace1 UTSW 9 45860264 missense probably damaging 1.00
R5818:Bace1 UTSW 9 45859049 missense possibly damaging 0.94
R6365:Bace1 UTSW 9 45854676 nonsense probably null
R6968:Bace1 UTSW 9 45854965 intron probably null
R7188:Bace1 UTSW 9 45856095 missense probably benign
R7517:Bace1 UTSW 9 45860261 missense probably benign 0.32
R7560:Bace1 UTSW 9 45856139 missense possibly damaging 0.50
R7729:Bace1 UTSW 9 45858445 missense probably damaging 1.00
X0020:Bace1 UTSW 9 45860182 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTCTCCTGAACACATTTAGGAAAC -3'
(R):5'- ACCTTAGGGATTGCCTCGTG -3'

Sequencing Primer
(F):5'- CCCCAAGAAATGGCTGAT -3'
(R):5'- GATTGCCTCGTGATCCTGTGC -3'
Posted On2014-06-23