Incidental Mutation 'R1819:Slc26a8'
ID204751
Institutional Source Beutler Lab
Gene Symbol Slc26a8
Ensembl Gene ENSMUSG00000036196
Gene Namesolute carrier family 26, member 8
Synonyms
MMRRC Submission 039847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R1819 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28637783-28689987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28684834 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 19 (F19I)
Ref Sequence ENSEMBL: ENSMUSP00000110412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114764]
Predicted Effect probably benign
Transcript: ENSMUST00000114764
AA Change: F19I

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110412
Gene: ENSMUSG00000036196
AA Change: F19I

DomainStartEndE-ValueType
Pfam:Sulfate_transp 90 491 1.2e-72 PFAM
low complexity region 494 509 N/A INTRINSIC
Pfam:STAS 542 792 7.3e-16 PFAM
low complexity region 881 896 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145224
Meta Mutation Damage Score 0.1122 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26 gene family of anion transporters. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. The expression of this gene appears to be restricted to spermatocytes. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit male sterility associated with sperm immotility, abnormal flagella and reduced acrosomal reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,981,056 probably null Het
Abhd17a T C 10: 80,586,636 T71A probably benign Het
Acad11 G A 9: 104,114,539 probably null Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afdn A G 17: 13,850,848 T783A probably damaging Het
Akap13 T A 7: 75,608,705 M359K probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atl1 T C 12: 69,963,300 S547P probably benign Het
Bace1 A T 9: 45,857,162 T252S possibly damaging Het
BC034090 A G 1: 155,225,829 S230P possibly damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Capn8 T A 1: 182,598,826 I242N probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc180 A G 4: 45,926,195 E1135G possibly damaging Het
Ccdc181 C T 1: 164,282,478 Q385* probably null Het
Cdh10 G T 15: 18,991,965 G437* probably null Het
Ceacam1 T A 7: 25,463,860 Q316L possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cers4 T A 8: 4,521,232 M267K probably benign Het
Csmd3 T C 15: 47,753,735 D1930G possibly damaging Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dus2 T A 8: 106,051,848 W377R probably damaging Het
E330034G19Rik A G 14: 24,298,013 D111G probably damaging Het
Erich4 C T 7: 25,615,290 R66Q possibly damaging Het
Fcgbp G T 7: 28,085,283 R256L probably benign Het
Fdxr A T 11: 115,276,104 F53Y probably damaging Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Foxo3 A T 10: 42,197,611 D84E probably benign Het
Gin1 A G 1: 97,785,226 probably null Het
Gli3 C T 13: 15,725,792 Q1255* probably null Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Gpr171 T C 3: 59,097,920 I145V probably benign Het
Gpr68 T A 12: 100,878,403 H294L possibly damaging Het
Gys2 T C 6: 142,461,186 E148G probably damaging Het
Heatr5b T C 17: 78,791,511 D1320G probably damaging Het
Ifnlr1 G T 4: 135,686,523 probably benign Het
Ift88 G A 14: 57,455,519 E392K probably damaging Het
Igsf9b T A 9: 27,311,593 S97T probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kcnj11 C T 7: 46,099,156 G248S probably benign Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Lilrb4a A G 10: 51,496,028 Y205C probably damaging Het
Lima1 T A 15: 99,819,936 H63L probably benign Het
Lonrf3 A G X: 36,358,708 I687V probably damaging Het
Lrba A G 3: 86,542,634 T2099A possibly damaging Het
Morn5 C T 2: 36,052,975 T29M probably damaging Het
Neurl1b G A 17: 26,438,700 R22H probably benign Het
Nr2e3 T C 9: 59,943,437 I380V probably damaging Het
Oas1c G A 5: 120,808,735 A10V possibly damaging Het
Olfr395 T C 11: 73,906,679 E271G probably benign Het
Olfr671 C T 7: 104,975,398 V196I probably benign Het
P3h3 T C 6: 124,854,932 T297A probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Plec C T 15: 76,179,906 R2056Q probably damaging Het
Plxna2 T A 1: 194,790,186 N1079K probably benign Het
Prr12 G C 7: 45,048,697 probably benign Het
Psip1 A G 4: 83,458,163 S480P probably benign Het
Ptpre A G 7: 135,668,993 probably benign Het
Pvalb A C 15: 78,202,584 V44G probably damaging Het
Rab3c T G 13: 110,084,135 Q164P possibly damaging Het
Rubcn T C 16: 32,826,914 K703R possibly damaging Het
Setd7 T G 3: 51,542,639 H122P probably benign Het
Slc6a14 A G X: 21,741,047 D625G probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Syngr3 A G 17: 24,687,722 F40L possibly damaging Het
Syt8 G A 7: 142,438,234 G21R possibly damaging Het
Tagln A G 9: 45,930,840 F152L probably benign Het
Tcf12 G A 9: 72,109,717 T36M probably damaging Het
Tdrd6 C T 17: 43,626,551 S1202N probably benign Het
Tekt2 T C 4: 126,323,736 K179E probably damaging Het
Tekt4 G T 17: 25,473,811 probably null Het
Tmprss5 G T 9: 49,107,164 R98L probably benign Het
Tns1 G T 1: 73,916,476 probably benign Het
Tpcn1 A C 5: 120,536,227 probably null Het
Ttc6 T C 12: 57,694,500 probably null Het
Ttf1 A G 2: 29,074,784 N706S possibly damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr17 A T 8: 54,690,124 S140T probably benign Het
Wdr19 A T 5: 65,212,891 I123F possibly damaging Het
Zer1 C T 2: 30,110,218 A317T probably benign Het
Zfp474 A G 18: 52,638,800 D175G probably damaging Het
Zfp598 T C 17: 24,681,130 probably benign Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Slc26a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc26a8 APN 17 28654948 missense probably benign 0.01
IGL02041:Slc26a8 APN 17 28642251 missense probably damaging 1.00
IGL02389:Slc26a8 APN 17 28638650 missense probably benign 0.00
E0370:Slc26a8 UTSW 17 28642387 missense possibly damaging 0.77
FR4449:Slc26a8 UTSW 17 28638316 small deletion probably benign
R1028:Slc26a8 UTSW 17 28672798 missense probably damaging 1.00
R1445:Slc26a8 UTSW 17 28648213 missense possibly damaging 0.72
R1501:Slc26a8 UTSW 17 28638562 missense possibly damaging 0.73
R1606:Slc26a8 UTSW 17 28638481 missense possibly damaging 0.73
R1950:Slc26a8 UTSW 17 28644640 missense probably benign 0.06
R1973:Slc26a8 UTSW 17 28663605 missense probably benign 0.01
R2203:Slc26a8 UTSW 17 28648007 missense probably benign 0.06
R3912:Slc26a8 UTSW 17 28644779 missense possibly damaging 0.92
R4176:Slc26a8 UTSW 17 28647999 missense probably benign 0.04
R4539:Slc26a8 UTSW 17 28659617 missense probably benign 0.00
R4661:Slc26a8 UTSW 17 28638684 missense probably benign 0.04
R4766:Slc26a8 UTSW 17 28638661 missense probably benign 0.01
R4850:Slc26a8 UTSW 17 28654883 missense probably benign 0.01
R4867:Slc26a8 UTSW 17 28663634 missense probably benign 0.05
R5521:Slc26a8 UTSW 17 28654859 missense probably benign 0.10
R5713:Slc26a8 UTSW 17 28661879 missense probably benign 0.01
R6092:Slc26a8 UTSW 17 28648155 missense probably damaging 1.00
R6135:Slc26a8 UTSW 17 28669940 missense probably benign 0.00
R6372:Slc26a8 UTSW 17 28644803 missense probably benign 0.08
R6543:Slc26a8 UTSW 17 28638401 missense possibly damaging 0.53
R6590:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6690:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6866:Slc26a8 UTSW 17 28638481 missense probably benign 0.27
R7057:Slc26a8 UTSW 17 28638397 missense possibly damaging 0.72
R7423:Slc26a8 UTSW 17 28648203 missense probably benign 0.32
R7496:Slc26a8 UTSW 17 28644850 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGCAAGGTTCTTACAGCAGG -3'
(R):5'- GCTTTCACCACTGAGCCATC -3'

Sequencing Primer
(F):5'- GCAAGGTTCTTACAGCAGGAATTC -3'
(R):5'- TCACTCTGTAGACCAGGCTGAC -3'
Posted On2014-06-23