Incidental Mutation 'R1820:Acbd3'
ID204763
Institutional Source Beutler Lab
Gene Symbol Acbd3
Ensembl Gene ENSMUSG00000026499
Gene Nameacyl-Coenzyme A binding domain containing 3
SynonymsD1Ertd10e, 8430407O11Rik, Pap7, Gocap1
MMRRC Submission 039848-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180726043-180754204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180745138 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 321 (N321S)
Ref Sequence ENSEMBL: ENSMUSP00000027780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027780]
Predicted Effect probably benign
Transcript: ENSMUST00000027780
AA Change: N321S

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027780
Gene: ENSMUSG00000026499
AA Change: N321S

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ACBP 81 167 3.2e-18 PFAM
coiled coil region 173 252 N/A INTRINSIC
low complexity region 268 305 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Pfam:GOLD_2 394 524 2.5e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192748
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
2700049A03Rik T C 12: 71,150,244 V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Actr3b T C 5: 25,849,158 probably null Het
Aldh5a1 T C 13: 24,927,572 D124G probably benign Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chac2 T A 11: 30,977,496 N141I probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fam160a1 T A 3: 85,665,829 T938S probably damaging Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Gabrg1 T A 5: 70,774,413 Y329F probably damaging Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Man2a2 A G 7: 80,358,933 F899L probably benign Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Phc2 C T 4: 128,743,543 A47V probably damaging Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in Acbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Acbd3 APN 1 180745105 missense possibly damaging 0.61
R0321:Acbd3 UTSW 1 180752305 missense probably damaging 1.00
R0365:Acbd3 UTSW 1 180738612 missense probably damaging 1.00
R0524:Acbd3 UTSW 1 180747059 small deletion probably benign
R0733:Acbd3 UTSW 1 180752218 missense possibly damaging 0.75
R0884:Acbd3 UTSW 1 180747059 small deletion probably benign
R1074:Acbd3 UTSW 1 180738548 nonsense probably null
R1327:Acbd3 UTSW 1 180733183 missense possibly damaging 0.95
R1352:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R4697:Acbd3 UTSW 1 180721944 unclassified probably benign
R5187:Acbd3 UTSW 1 180736732 nonsense probably null
R5217:Acbd3 UTSW 1 180726373 missense probably benign 0.18
R5368:Acbd3 UTSW 1 180722095 unclassified probably benign
R6018:Acbd3 UTSW 1 180752338 missense possibly damaging 0.88
R7072:Acbd3 UTSW 1 180726369 missense probably benign
R7366:Acbd3 UTSW 1 180734499 missense probably benign 0.41
X0027:Acbd3 UTSW 1 180747030 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGTGCTGTGCTGGCATATTTAAC -3'
(R):5'- CAGGAGGTCTAAGAGTGACACC -3'

Sequencing Primer
(F):5'- GGATCTGCCTGACTTCATCATGAG -3'
(R):5'- GGTCTAAGAGTGACACCTAGATG -3'
Posted On2014-06-23