Incidental Mutation 'R1820:Fam160a1'
ID204772
Institutional Source Beutler Lab
Gene Symbol Fam160a1
Ensembl Gene ENSMUSG00000051000
Gene Namefamily with sequence similarity 160, member A1
Synonyms9930021J17Rik
MMRRC Submission 039848-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location85660061-85817291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85665829 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 938 (T938S)
Ref Sequence ENSEMBL: ENSMUSP00000113235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094148] [ENSMUST00000118408] [ENSMUST00000119077] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000094148
AA Change: T938S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091700
Gene: ENSMUSG00000051000
AA Change: T938S

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.2e-102 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118408
AA Change: T938S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113235
Gene: ENSMUSG00000051000
AA Change: T938S

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.1e-98 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119077
SMART Domains Protein: ENSMUSP00000112705
Gene: ENSMUSG00000051000

DomainStartEndE-ValueType
low complexity region 67 84 N/A INTRINSIC
low complexity region 197 206 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126445
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
2700049A03Rik T C 12: 71,150,244 V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Acbd3 A G 1: 180,745,138 N321S probably benign Het
Actr3b T C 5: 25,849,158 probably null Het
Aldh5a1 T C 13: 24,927,572 D124G probably benign Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chac2 T A 11: 30,977,496 N141I probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Gabrg1 T A 5: 70,774,413 Y329F probably damaging Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Man2a2 A G 7: 80,358,933 F899L probably benign Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Phc2 C T 4: 128,743,543 A47V probably damaging Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in Fam160a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam160a1 APN 3 85672618 missense probably benign 0.01
IGL01102:Fam160a1 APN 3 85665501 intron probably benign
IGL01317:Fam160a1 APN 3 85672846 missense probably benign 0.01
IGL01759:Fam160a1 APN 3 85688447 missense probably damaging 1.00
IGL02007:Fam160a1 APN 3 85722445 missense probably damaging 1.00
IGL02037:Fam160a1 APN 3 85730632 missense probably damaging 0.99
IGL02163:Fam160a1 APN 3 85688552 missense possibly damaging 0.92
IGL02192:Fam160a1 APN 3 85673326 missense possibly damaging 0.82
IGL02617:Fam160a1 APN 3 85673037 missense probably benign 0.00
PIT4378001:Fam160a1 UTSW 3 85730551 missense probably damaging 1.00
PIT4520001:Fam160a1 UTSW 3 85672472 nonsense probably null
PIT4651001:Fam160a1 UTSW 3 85683641 missense probably damaging 1.00
R0590:Fam160a1 UTSW 3 85672376 missense probably benign 0.13
R0625:Fam160a1 UTSW 3 85730500 missense possibly damaging 0.84
R0648:Fam160a1 UTSW 3 85730614 missense probably damaging 1.00
R0931:Fam160a1 UTSW 3 85673243 missense probably benign
R0940:Fam160a1 UTSW 3 85665490 missense possibly damaging 0.92
R0941:Fam160a1 UTSW 3 85673059 missense probably benign 0.03
R1115:Fam160a1 UTSW 3 85722495 missense probably benign 0.02
R1161:Fam160a1 UTSW 3 85672468 missense probably damaging 0.96
R1460:Fam160a1 UTSW 3 85730876 missense probably damaging 1.00
R1503:Fam160a1 UTSW 3 85672477 missense possibly damaging 0.70
R1545:Fam160a1 UTSW 3 85665954 missense probably damaging 1.00
R1907:Fam160a1 UTSW 3 85672633 missense probably benign 0.00
R1911:Fam160a1 UTSW 3 85661218 missense probably benign 0.12
R1928:Fam160a1 UTSW 3 85688531 missense probably damaging 1.00
R2200:Fam160a1 UTSW 3 85730321 missense probably damaging 1.00
R2235:Fam160a1 UTSW 3 85661101 missense probably damaging 0.97
R2373:Fam160a1 UTSW 3 85676097 nonsense probably null
R3084:Fam160a1 UTSW 3 85665968 critical splice acceptor site probably null
R4125:Fam160a1 UTSW 3 85665383 missense possibly damaging 0.87
R4601:Fam160a1 UTSW 3 85741180 missense probably damaging 1.00
R4612:Fam160a1 UTSW 3 85730372 nonsense probably null
R4665:Fam160a1 UTSW 3 85730681 missense probably damaging 1.00
R4673:Fam160a1 UTSW 3 85730713 missense probably damaging 1.00
R4707:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4783:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4785:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4825:Fam160a1 UTSW 3 85673432 missense possibly damaging 0.93
R4884:Fam160a1 UTSW 3 85683611 missense probably damaging 1.00
R5653:Fam160a1 UTSW 3 85722501 missense probably damaging 1.00
R5663:Fam160a1 UTSW 3 85672433 missense probably benign
R5764:Fam160a1 UTSW 3 85665865 missense probably damaging 1.00
R6134:Fam160a1 UTSW 3 85673344 missense possibly damaging 0.93
R6284:Fam160a1 UTSW 3 85672688 missense probably benign 0.01
R6789:Fam160a1 UTSW 3 85672558 nonsense probably null
R6843:Fam160a1 UTSW 3 85673045 missense probably damaging 0.96
R7305:Fam160a1 UTSW 3 85730524 missense probably damaging 1.00
R7406:Fam160a1 UTSW 3 85730477 missense probably benign 0.13
R7448:Fam160a1 UTSW 3 85672564 missense probably benign 0.00
R7469:Fam160a1 UTSW 3 85672762 missense probably benign 0.00
R7578:Fam160a1 UTSW 3 85665898 missense probably damaging 0.99
R7707:Fam160a1 UTSW 3 85676253 missense probably benign 0.21
R8071:Fam160a1 UTSW 3 85730561 missense probably damaging 1.00
R8093:Fam160a1 UTSW 3 85672804 missense probably benign 0.01
R8151:Fam160a1 UTSW 3 85688540 missense probably damaging 1.00
R8391:Fam160a1 UTSW 3 85688481 missense probably damaging 0.98
R8406:Fam160a1 UTSW 3 85672720 missense probably benign 0.02
Z1176:Fam160a1 UTSW 3 85673201 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCCTGTGTTCCTGGTAAG -3'
(R):5'- TGCAGTTCTGCGGACACTTG -3'

Sequencing Primer
(F):5'- TGGTAAGGAACTCTCAAAACATCAAG -3'
(R):5'- GTCCCTCATGTCCAGCCAG -3'
Posted On2014-06-23