Incidental Mutation 'R1820:Gabrg1'
ID204778
Institutional Source Beutler Lab
Gene Symbol Gabrg1
Ensembl Gene ENSMUSG00000001260
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 1
SynonymsGabaA
MMRRC Submission 039848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location70751047-70842617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70774413 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 329 (Y329F)
Ref Sequence ENSEMBL: ENSMUSP00000031119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031119] [ENSMUST00000199705]
Predicted Effect probably damaging
Transcript: ENSMUST00000031119
AA Change: Y329F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031119
Gene: ENSMUSG00000001260
AA Change: Y329F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 40 46 N/A INTRINSIC
Pfam:Neur_chan_LBD 64 270 7e-51 PFAM
Pfam:Neur_chan_memb 277 378 2.3e-36 PFAM
low complexity region 411 422 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197068
Predicted Effect probably benign
Transcript: ENSMUST00000199705
SMART Domains Protein: ENSMUSP00000142454
Gene: ENSMUSG00000001260

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 35 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 265 1.7e-50 PFAM
Pfam:Neur_chan_memb 272 304 9.5e-12 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 395 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
2700049A03Rik T C 12: 71,150,244 V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Acbd3 A G 1: 180,745,138 N321S probably benign Het
Actr3b T C 5: 25,849,158 probably null Het
Aldh5a1 T C 13: 24,927,572 D124G probably benign Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chac2 T A 11: 30,977,496 N141I probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fam160a1 T A 3: 85,665,829 T938S probably damaging Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Man2a2 A G 7: 80,358,933 F899L probably benign Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Phc2 C T 4: 128,743,543 A47V probably damaging Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in Gabrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Gabrg1 APN 5 70815955 critical splice donor site probably null
IGL00798:Gabrg1 APN 5 70782283 missense probably damaging 1.00
IGL01012:Gabrg1 APN 5 70778169 missense probably benign 0.03
IGL01597:Gabrg1 APN 5 70782348 missense probably damaging 1.00
IGL01637:Gabrg1 APN 5 70777205 missense probably damaging 1.00
IGL02589:Gabrg1 APN 5 70842152 nonsense probably null
IGL03031:Gabrg1 APN 5 70794682 nonsense probably null
IGL03346:Gabrg1 APN 5 70778131 missense possibly damaging 0.89
PIT4260001:Gabrg1 UTSW 5 70782280 missense probably benign 0.01
R0197:Gabrg1 UTSW 5 70774389 missense probably damaging 1.00
R1271:Gabrg1 UTSW 5 70777144 missense probably damaging 0.98
R1795:Gabrg1 UTSW 5 70782253 missense possibly damaging 0.83
R1817:Gabrg1 UTSW 5 70754251 missense probably benign 0.08
R2254:Gabrg1 UTSW 5 70782364 nonsense probably null
R4566:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R4768:Gabrg1 UTSW 5 70754173 missense probably damaging 0.99
R4976:Gabrg1 UTSW 5 70774411 missense possibly damaging 0.95
R5104:Gabrg1 UTSW 5 70774432 missense probably damaging 1.00
R6062:Gabrg1 UTSW 5 70780713 missense probably damaging 1.00
R6086:Gabrg1 UTSW 5 70754053 missense probably damaging 1.00
R6148:Gabrg1 UTSW 5 70774461 missense probably damaging 1.00
R6234:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R6724:Gabrg1 UTSW 5 70754209 missense possibly damaging 0.80
R6786:Gabrg1 UTSW 5 70754267 missense probably benign 0.00
R6794:Gabrg1 UTSW 5 70815971 missense probably damaging 1.00
R7209:Gabrg1 UTSW 5 70754170 missense probably damaging 0.98
R7654:Gabrg1 UTSW 5 70778161 missense probably benign 0.44
R7671:Gabrg1 UTSW 5 70815980 missense probably damaging 1.00
R7844:Gabrg1 UTSW 5 70774332 missense probably damaging 1.00
R7877:Gabrg1 UTSW 5 70816072 missense probably damaging 0.99
R8219:Gabrg1 UTSW 5 70774300 nonsense probably null
X0027:Gabrg1 UTSW 5 70754261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGTTCCCTCCTGTGTGAAGTTATC -3'
(R):5'- GCCATGGTTACTAGTAATTCTTTCTGG -3'

Sequencing Primer
(F):5'- CTCCTGTGTGAAGTTATCATCATAAC -3'
(R):5'- AGTAATTCTTTCTGGCAATCATATCC -3'
Posted On2014-06-23