Incidental Mutation 'R1820:Man2a2'
ID204786
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Namemannosidase 2, alpha 2
Synonymsalpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission 039848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80349097-80371375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80358933 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 899 (F899L)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206301] [ENSMUST00000206807]
Predicted Effect probably benign
Transcript: ENSMUST00000098346
AA Change: F899L

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: F899L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205535
Predicted Effect probably benign
Transcript: ENSMUST00000205853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206066
Predicted Effect probably benign
Transcript: ENSMUST00000206301
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206973
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
2700049A03Rik T C 12: 71,150,244 V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Acbd3 A G 1: 180,745,138 N321S probably benign Het
Actr3b T C 5: 25,849,158 probably null Het
Aldh5a1 T C 13: 24,927,572 D124G probably benign Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chac2 T A 11: 30,977,496 N141I probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fam160a1 T A 3: 85,665,829 T938S probably damaging Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Gabrg1 T A 5: 70,774,413 Y329F probably damaging Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Phc2 C T 4: 128,743,543 A47V probably damaging Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80353319 missense probably damaging 1.00
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAGGTATTCCTGTCTGTCTGTC -3'
(R):5'- CGCTGGAATAGTCCCTTGTTG -3'

Sequencing Primer
(F):5'- CCTTTATGAGGGCTCCAGGAATC -3'
(R):5'- GGAATAGTCCCTTGTTGTGCTCAC -3'
Posted On2014-06-23