Mutagenetix > Incidental Mutation

Incidental Mutation 'R1820:Myo9b'

204790

Institutional Source

Beutler Lab

Gene Symbol

Myo9b

Ensembl Gene

ENSMUSG00000004677

Gene Name

myosin IXb

Synonyms

MMRRC Submission

039848-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.852) question?

Stock #

R1820 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71272714-71360713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71333358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 633 (I633T)

Ref Sequence

ENSEMBL: ENSMUSP00000129220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071935
AA Change: I633T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: I633T

Domain	Start	End	E-Value	Type
RA	15	114	3.7e-30	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	1.2e-3	SMART
IQ	978	1000	1.6e-5	SMART
IQ	1001	1022	4.3e-5	SMART
IQ	1023	1045	8.4e-5	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1232	1246	N/A	INTRINSIC
Blast:MYSc	1247	1323	3e-19	BLAST
low complexity region	1348	1359	N/A	INTRINSIC
coiled coil region	1563	1590	N/A	INTRINSIC
C1	1591	1639	1.7e-14	SMART
RhoGAP	1668	1843	4.7e-71	SMART
coiled coil region	1901	1925	N/A	INTRINSIC
low complexity region	1940	1952	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168839
AA Change: I633T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: I633T

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1915	1939	N/A	INTRINSIC
low complexity region	1954	1966	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170242
AA Change: I633T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: I633T

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1931	1955	N/A	INTRINSIC
low complexity region	1970	1982	N/A	INTRINSIC
low complexity region	1992	2003	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212173

Predicted Effect

probably damaging
Transcript: ENSMUST00000212935
AA Change: I633T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,269,645	K3106E	unknown	Het
2700049A03Rik	T	C	12: 71,150,244	V197A	possibly damaging	Het
9230109A22Rik	T	C	15: 25,139,090		noncoding transcript	Het
Acbd3	A	G	1: 180,745,138	N321S	probably benign	Het
Actr3b	T	C	5: 25,849,158		probably null	Het
Aldh5a1	T	C	13: 24,927,572	D124G	probably benign	Het
Arhgap35	G	A	7: 16,561,949	R1064W	possibly damaging	Het
Arhgef9	T	A	X: 95,081,536	I225F	probably damaging	Het
Arl16	T	C	11: 120,466,761	T43A	probably damaging	Het
Camsap3	T	C	8: 3,603,485	W409R	probably damaging	Het
Cfap43	T	A	19: 47,897,216	H320L	probably damaging	Het
Chac2	T	A	11: 30,977,496	N141I	probably damaging	Het
Chtf18	C	A	17: 25,725,939	G211C	probably damaging	Het
Cwf19l1	T	A	19: 44,127,387	Y201F	probably benign	Het
Dcun1d1	A	T	3: 35,919,004	L114*	probably null	Het
Fam160a1	T	A	3: 85,665,829	T938S	probably damaging	Het
Fdps	A	T	3: 89,095,043	H249Q	probably benign	Het
Gabrg1	T	A	5: 70,774,413	Y329F	probably damaging	Het
Kctd8	T	A	5: 69,340,341	I321F	probably damaging	Het
Kdm5b	G	T	1: 134,597,670	R299L	possibly damaging	Het
Kif23	T	C	9: 61,926,438	T494A	possibly damaging	Het
Kmt2e	A	G	5: 23,473,547	H208R	probably damaging	Het
Lipo5	A	T	19: 33,464,595		probably null	Het
Lrrc28	G	T	7: 67,641,111	T54K	probably damaging	Het
Luc7l2	G	A	6: 38,598,819		probably null	Het
Man2a2	A	G	7: 80,358,933	F899L	probably benign	Het
Nynrin	A	T	14: 55,870,378	I981F	possibly damaging	Het
Olfr262	A	T	19: 12,241,248	S138T	probably damaging	Het
Olfr945	A	G	9: 39,258,399	I91T	possibly damaging	Het
Pank1	A	G	19: 34,877,684		probably null	Het
Phc2	C	T	4: 128,743,543	A47V	probably damaging	Het
Plekhs1	A	G	19: 56,478,522	R262G	possibly damaging	Het
Pnp2	C	A	14: 50,964,457	P300Q	possibly damaging	Het
Polq	T	A	16: 37,029,418	S345T	possibly damaging	Het
Prag1	A	G	8: 36,103,804	T514A	probably benign	Het
Psmd5	T	C	2: 34,870,746		probably null	Het
Rfx6	T	G	10: 51,723,125		probably null	Het
Rhbdd2	G	A	5: 135,636,049	C78Y	probably damaging	Het
Rnf157	G	T	11: 116,354,651	P313T	probably damaging	Het
Ryr2	A	G	13: 11,587,316	L4560P	probably damaging	Het
Scai	A	T	2: 39,106,978	M268K	possibly damaging	Het
Scd3	A	T	19: 44,241,806	T343S	probably benign	Het
Scimp	A	T	11: 70,791,597	S98T	probably benign	Het
Sfrp2	A	G	3: 83,773,154	N207S	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Sis	T	C	3: 72,921,142	Y1200C	probably damaging	Het
Sp1	T	A	15: 102,409,076	S343R	possibly damaging	Het
Spata31d1a	A	T	13: 59,701,255	C1020S	possibly damaging	Het
Spink5	A	G	18: 43,989,419	N317S	possibly damaging	Het
Sptbn2	A	G	19: 4,726,596	D224G	probably damaging	Het
St8sia3	T	C	18: 64,269,632	I114T	probably damaging	Het
Zscan5b	C	A	7: 6,239,163	H460Q	probably damaging	Het

Other mutations in Myo9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Myo9b	APN	8	71348735	missense	probably benign
IGL01020:Myo9b	APN	8	71352000	missense	probably benign
IGL01479:Myo9b	APN	8	71359342	missense	probably damaging	1.00
IGL01704:Myo9b	APN	8	71359642	missense	probably damaging	0.98
IGL01761:Myo9b	APN	8	71349152	missense	probably damaging	0.96
IGL01766:Myo9b	APN	8	71290517	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71356318	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71355257	missense	possibly damaging	0.93
IGL01838:Myo9b	APN	8	71334390	missense	probably damaging	0.99
IGL02318:Myo9b	APN	8	71354124	missense	probably damaging	0.98
IGL02333:Myo9b	APN	8	71358993	missense	possibly damaging	0.65
IGL02340:Myo9b	APN	8	71291045	missense	probably damaging	1.00
IGL02514:Myo9b	APN	8	71291006	missense	probably damaging	1.00
IGL02593:Myo9b	APN	8	71290773	missense	probably damaging	1.00
IGL03075:Myo9b	APN	8	71354527	missense	probably damaging	1.00
IGL03332:Myo9b	APN	8	71348774	missense	possibly damaging	0.78
avantgarde	UTSW	8	71344162	missense	probably damaging	1.00
Freaky	UTSW	8	71290819	missense	probably damaging	1.00
iconoclastic	UTSW	8	71290475	missense	probably benign	0.37
unconventional	UTSW	8	71348597	missense	probably benign	0.00
PIT4418001:Myo9b	UTSW	8	71322947	missense	probably damaging	1.00
PIT4651001:Myo9b	UTSW	8	71342812	missense	possibly damaging	0.83
R0023:Myo9b	UTSW	8	71333768	missense	probably damaging	1.00
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0144:Myo9b	UTSW	8	71346043	missense	probably damaging	1.00
R0207:Myo9b	UTSW	8	71355225	splice site	probably benign
R0226:Myo9b	UTSW	8	71353832	missense	probably damaging	1.00
R0227:Myo9b	UTSW	8	71344162	missense	probably damaging	1.00
R0244:Myo9b	UTSW	8	71321813	missense	probably damaging	1.00
R0277:Myo9b	UTSW	8	71355952	splice site	probably benign
R0362:Myo9b	UTSW	8	71347770	missense	probably damaging	1.00
R0689:Myo9b	UTSW	8	71330756	missense	probably damaging	1.00
R0844:Myo9b	UTSW	8	71290475	missense	probably benign	0.37
R1051:Myo9b	UTSW	8	71355822	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1526:Myo9b	UTSW	8	71355764	missense	probably damaging	1.00
R1544:Myo9b	UTSW	8	71290976	missense	probably damaging	1.00
R1565:Myo9b	UTSW	8	71315192	missense	possibly damaging	0.46
R1645:Myo9b	UTSW	8	71322978	missense	probably damaging	1.00
R1745:Myo9b	UTSW	8	71354047	missense	probably damaging	1.00
R2037:Myo9b	UTSW	8	71290866	missense	probably damaging	1.00
R2050:Myo9b	UTSW	8	71290550	missense	probably damaging	1.00
R2056:Myo9b	UTSW	8	71359690	missense	possibly damaging	0.78
R2129:Myo9b	UTSW	8	71333699	missense	probably damaging	1.00
R2423:Myo9b	UTSW	8	71327940	missense	probably damaging	1.00
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2873:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2874:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2920:Myo9b	UTSW	8	71325857	missense	probably damaging	0.98
R2926:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2939:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2940:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3033:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3040:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3689:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3691:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3735:Myo9b	UTSW	8	71348597	missense	probably benign	0.00
R4194:Myo9b	UTSW	8	71359624	missense	possibly damaging	0.71
R4258:Myo9b	UTSW	8	71355765	missense	probably damaging	1.00
R4457:Myo9b	UTSW	8	71290999	missense	probably damaging	1.00
R4478:Myo9b	UTSW	8	71291081	missense	probably damaging	1.00
R4496:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R4544:Myo9b	UTSW	8	71327941	missense	probably damaging	1.00
R4580:Myo9b	UTSW	8	71315135	missense	probably damaging	1.00
R4736:Myo9b	UTSW	8	71356592	missense	probably damaging	1.00
R5068:Myo9b	UTSW	8	71349055	missense	probably damaging	1.00
R5124:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
R5194:Myo9b	UTSW	8	71349089	missense	probably benign	0.01
R5296:Myo9b	UTSW	8	71333388	missense	possibly damaging	0.69
R5528:Myo9b	UTSW	8	71323274	missense	probably benign	0.06
R5664:Myo9b	UTSW	8	71359882	missense	probably benign	0.13
R5677:Myo9b	UTSW	8	71343686	missense	probably damaging	1.00
R5680:Myo9b	UTSW	8	71290372	missense	probably benign	0.00
R5982:Myo9b	UTSW	8	71348396	missense	probably benign	0.05
R6344:Myo9b	UTSW	8	71327914	missense	probably damaging	1.00
R6352:Myo9b	UTSW	8	71348410	missense	probably benign	0.16
R6352:Myo9b	UTSW	8	71348411	missense	probably benign
R6411:Myo9b	UTSW	8	71322955	nonsense	probably null
R6425:Myo9b	UTSW	8	71333628	missense	probably damaging	1.00
R6505:Myo9b	UTSW	8	71355857	missense	possibly damaging	0.88
R6743:Myo9b	UTSW	8	71352159	splice site	probably null
R6811:Myo9b	UTSW	8	71356578	missense	probably damaging	1.00
R6813:Myo9b	UTSW	8	71323305	missense	probably damaging	1.00
R6954:Myo9b	UTSW	8	71290819	missense	probably damaging	1.00
R7124:Myo9b	UTSW	8	71333701	nonsense	probably null
R7255:Myo9b	UTSW	8	71290891	missense	probably damaging	1.00
R7293:Myo9b	UTSW	8	71325905	missense	probably benign	0.00
R7342:Myo9b	UTSW	8	71355774	missense	probably damaging	1.00
R7451:Myo9b	UTSW	8	71352188	missense	probably benign	0.28
R7482:Myo9b	UTSW	8	71342798	missense	probably benign	0.00
R7508:Myo9b	UTSW	8	71354801	missense	probably benign	0.00
R7957:Myo9b	UTSW	8	71354761	missense	probably benign	0.12
R8062:Myo9b	UTSW	8	71321813	missense	probably damaging	0.99
R8108:Myo9b	UTSW	8	71348342	missense	probably damaging	0.99
R8197:Myo9b	UTSW	8	71290963	missense	probably damaging	1.00
R8274:Myo9b	UTSW	8	71359836	missense	probably benign	0.00
R8686:Myo9b	UTSW	8	71334322	missense	probably benign	0.01
R8731:Myo9b	UTSW	8	71353842	critical splice donor site	probably null
R8924:Myo9b	UTSW	8	71349031	missense	probably benign
R9056:Myo9b	UTSW	8	71352262	missense	probably benign	0.17
R9117:Myo9b	UTSW	8	71347807	missense	probably benign	0.03
R9151:Myo9b	UTSW	8	71355227	splice site	probably benign
R9315:Myo9b	UTSW	8	71349167	missense	possibly damaging	0.54
R9332:Myo9b	UTSW	8	71359602	missense	probably benign	0.07
R9364:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
R9569:Myo9b	UTSW	8	71358985	missense	probably benign
R9581:Myo9b	UTSW	8	71359899	missense	probably benign	0.19
R9600:Myo9b	UTSW	8	71290431	missense	possibly damaging	0.80
X0066:Myo9b	UTSW	8	71323898	missense	probably damaging	1.00
Z1177:Myo9b	UTSW	8	71290709	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCACATGGATGAGAAGC -3'
(R):5'- AGTCCTGGCTCGTATTCAGG -3'

Sequencing Primer
(F):5'- AGATCTGAGTTCAATTCCCAGGGTC -3'
(R):5'- GTTTGGGATGATTGCAAGCACC -3'

Posted On

2014-06-23